Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
OH2383 C. elegans eno-8(ot8) III; oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.
OH13405 C. elegans inx-6(ot804 [inx-6::SL2::NLS::yfp::H2B]) IV. Show Description
inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH13525 C. elegans inx-6(ot805 [inx-6::gfp]) IV. Show Description
inx-6(ot805) was generated by the insertion of GFP into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH13813 C. elegans oig-8(ot818) II. Show Description
OH13830 C. elegans sax-7(ot820) IV; oyIs14 V. Show Description
oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.
OH13908 C. elegans daf-16(ot821[daf-16::mKate2::3xFLAG]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH13988 C. elegans ieSi57 II; unc-3(ot837[unc-3::mNeonGreen::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID* degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T, Hobert O. Elife. 2017 Apr 19;6:e24100. doi: 10.7554/eLife.24100. PMID: 28422646.
OH14014 C. elegans inx-6(ot804 ot840) IV. Show Description
inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. ot840 was created by targeted disruption of the conserved TAATTA in the tagged inx-6(ot804). Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
OH14021 C. elegans hpl-1(ot841 [hpl-1::mKate2]) X. Show Description
ot841[hpl-1::mKate2]. Endogenous hpl-1 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 12. This tag was based on a published hpl-1 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.
OH14070 C. elegans bnc-1(ot845[bnc-1::mNeonGreen::AID*]) V. Show Description
bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID*). Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346
OH14125 C. elegans daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID*]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID* at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580
OH14130 C. elegans che-1(ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.
OH14220 C. elegans hpl-2(ot860 [hpl-2::mKate2]) III. Show Description
ot860[hpl-2::mKate2]. Grows normally at 15-20C. Endogenous hpl-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 96; tags both isoforms of hpl-2. This tag was based on a published hpl-2 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.
OH14221 C. elegans met-2(ot861[met-2::mKate2]) III. Show Description
ot861[met-2::mKate2] III. Maintain at 15-20C. Endogenous met-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted at the C-terminus using a small protein bridge present in the plasmids (Dickinson et al., 2015). Reference: Patel T & Hobert O. eLife 2017.
OH14357 C. elegans mab-9(ot863[mab-9::TagRFP::AID*]) II. Show Description
mab-9(ot863[mab-9::TagRFP::AID*]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID*). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron. 2017 Jan 4;93(1):80-98. doi: 10.1016/j.neuron.2016.11.036. PMID: 28056346
OH14420 C. elegans pals-22(ot811) III; otIs381 V; otEx6761. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14429 C. elegans pals-22(ot811) III; otIs381 V; otEx6769. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH14486 C. elegans gcy-5(ot835[gcy-5::SL2::mNeonGreen]) II; otTi6 X. Show Description
ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).
OH14551 C. elegans unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III. Show Description
unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III.
OH14589 C. elegans daf-12(ot870[daf-12::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14654 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; daf-2(e1370) III. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva U. et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586; PMCID: PMC8099054.
OH14783 C. elegans kyIs140 I; oig-8(ot818) II; otTi20. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.
OH14785 C. elegans kyIs140 I; oig-8(ot818) II; otTi22. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.
OH14864 C. elegans kyIs140 I; oig-8(ot818) II; otTi24. Show Description
kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.
OH14888 C. elegans daf-16(ot853[daf-16::mNG::3xFlag::AID*]) I; ieSi57 II; daf-2(e1370) III. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva U et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14891 C. elegans daf-12(ot874[daf-12::TagRFP::3xFlag::AID*]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-12 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14892 C. elegans daf-3(ot875[daf-3::GFP::3xFlag]) X. Show Description
Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted
OH14896 C. elegans daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. Show Description
Superficially wildtype. CRISPR/Cas9-engineered AID* conditional daf-3 allele. Reference: Aghayeva et al., PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14897 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi60 II; daf-2(e1370) III. Show Description
ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14945 C. elegans daf-16(ot853[daf-16::mNeonGreen::3xFlag::AID*]) I; ieSi61 II; daf-2(e1370) III. Show Description
ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14946 C. elegans ieSi57 II; daf-7(e1372) III; daf-3(ot877[daf-3::TagRFP-T::3xFlag::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14984 C. elegans daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X. Show Description
Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14986 C. elegans ieSi57 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID* conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH14989 C. elegans ieSi60 II; daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP-T::AID*]) X. Show Description
ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH15178 C. elegans pals-22(ot810) III; otIs381 V. Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15179 C. elegans pals-22(ot811) III; otIs381 V Show Description
otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.
OH15227 C. elegans unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.
OH15535 C. elegans inx-6(ot805[inx-6::GFP]) IV; otEx7230. Show Description
otEx7230 [ets-5p::TagRFP + rol-6(su1006)]. Transgene contains 3.25 kb of ets-5 promoter fragment. GFP tag inserted into endogenous inx-6 locus.
OH15579 C. elegans che-1(ot908 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15683 C. elegans che-1(ot871 ot856[che-1::SEC-GFP::TEV::3xFLAG]) I. Show Description
ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).
OH15845 C. elegans daf-16(ot853[daf-16::mNG::AID*]) I; daf-2(e1370) III; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH15913 C. elegans daf-7(e1372) III; daf-12(ot874[daf-12::TagRFP::AID*]) X; otIs730. Show Description
otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al. PLoS Biol. 2021 Apr 23;19(4):e3001204. doi: 10.1371/journal.pbio.3001204. PMID: 33891586.
OH16372 C. elegans che-7(ot866[che-7::TagRFP]) V. Show Description
tagRFP inserted into endogenous che-7 locus.
OH17582 C. elegans daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II; daf-2(e1370) III. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Temperature-senstive daf(c): maintain at 15C. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Constitutive dauer formation at 25 C due to daf-2(e1370). Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19078 C. elegans daf-16(ot853[daf-16::mNG::AID*]) I; otIs908 V. Show Description
otIs908 [pha-4(prom2)::TIR1(F79G)::mTur2::tbb-2 3'UTR + unc-122p::mCherry::unc-54 3' UTR] V. TIR1(F79G) expression in all 22 enteric neurons (20 pharyngeal neurons, AVL and DVB), RIS and PVT. The multicopy array was inserted at the oxTi553 landing site using the Fluorescent Landmark Interference (FLInt) method. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH19232 C. elegans daf-16(ot853[daf-16::mNG::AID*]) I; otSi2 II. Show Description
otSi2 [ges-1p::TIR1(F79G)::mRuby::unc-54 3'UTR + Cbr-unc-119(+) *ieSi61] II. Intestine-specific TIR1 sequence in ieSi61 allele was edited to TIR1(F79G) using CRISPR/Cas9 to make it compatible with AID2. [TCC GTC GAG CTC AAG GGA AAG CCA CAC TTC] edited to [AGT GTC GAA TTG AAG GGA AAG CCA CAC GGA]. This strain can be used to deplete DAF-16 specifically from the intestine with the modified auxin 5-Ph-IAA. Reference: Sural S, et al. Sci Adv. 2025 Sep 26;11(39):eadw1270. doi: 10.1126/sciadv.adw1270. PMID: 40991693.
OH4974 C. elegans otIs114 I; lsy-12(ot89) V. Show Description
otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.
OH7317 C. elegans F21H12.1(ot86) rol-6(e187) II; ntIs1 V. Show Description
ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain.
SYS148 C. elegans ujIs113 II; unc-3(ot837([unc-3::mNeonGreen::AID*]) X. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
SYS149 C. elegans ujIs113 II; bnc-1(ot845([bnc-1::mNeonGreen::AID*]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.