oxIs12 [unc-47p::GFP + lin-15(+)]. Ectopic DVB outgrowth.

inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

inx-6(ot805) was generated by the insertion of GFP into the endogenous inx-6 locus. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

oyIs14 [sra-6::GFP + lin-15(+)] V. ot820 is an 8bp deletion 15bp from the start of the sax-7S start codon, resulting in a frameshift and sax-7S isoform-specific null allele.

CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. The endogenous unc-3 locus is tagged with mNeonGreen and AID degron. mNeonGreen expression is seen in the cholinergic motor neurons, command interneurons, and ASI. Reference: Patel T & Hobert O. eLife 2017.

inx-6(ot804) was generated by the insertion of SL2::NLS::YFP::H2B into the endogenous inx-6 locus. ot840 was created by targeted disruption of the conserved TAATTA in the tagged inx-6(ot804). Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.

ot841[hpl-1::mKate2]. Endogenous hpl-1 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 12. This tag was based on a published hpl-1 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.

bnc-1 was modified by CRISPR/Cas9 to create both a GFP-tagged reporter and conditional allele using the auxin-inducible degron (AID). Reference: Kerk SY, et al. Neuron 2017 (in press).

mNeonGreen tag inserted into endogenous daf-16 locus; AID at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 tagged with GFP. Nuclear GFP localization in ASE neurons. Reference: Leyva-Díaz E, et al. Genetics. 2017 Oct;207(2):529-545.

ot860[hpl-2::mKate2]. Grows normally at 15-20C. Endogenous hpl-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted into the protein after amino acid 96; tags both isoforms of hpl-2. This tag was based on a published hpl-2 protein fusion (Couteau et al., 2002). Reference: Patel T & Hobert O. eLife 2017.

ot861[met-2::mKate2] III. Maintain at 15-20C. Endogenous met-2 locus tagged with mKate2 using CRISPR/Cas9. mKate2 was inserted at the C-terminus using a small protein bridge present in the plasmids (Dickinson et al., 2015). Reference: Patel T & Hobert O. eLife 2017.

mab-9(ot863[mab-9::TagRFP::AID]) II. mab-9 was modified by CRISPR/Cas9 to create a conditional allele using the auxin-inducible degron (AID). RFP is not visible in this strain. Reference: Kerk SY, et al. Neuron 2017 (in press).

otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6761 [pals-22(+) + ttx-3p::mChOPTI]; derived from PCR fragment containing the genomic pals-22 locus. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6761 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.

otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. otEx6769 [pals-22(fosmid) + myo-2p::mChOPTI]; derived from NotI digestion of WRM0616DC09. pals-22(ot811) mutant shows transgene-silencing phenotype; otEx6769 rescues ot811 and restores otIs381 expression at wild-type levels. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.

ot835 [gcy-5::SL2::mNeonGreen] III. otTi6 [hsp16-41p::che-1::2xFLAG] X. otTi6 is a miniMOS insertion of heatshock inducible che-1. Under normal growth conditions, very dim expression of gcy-5 is observed in the ASER and RIGL/R neurons. Upon heatshock, induction of CHE-1 leads to ectopic expression of gcy-5 (ectopic expression varies depending upon age at heatshock and genetic background).

unc-25(ot867[unc-25::SL2::1xNLS::GFP::H2B]) III.

Superficially wildtype. GFP tag inserted into endogenous daf-12 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted

Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background (TIR1-less control). Reference: Aghayeva et al., submitted

kyIs140: [str-2::GFP + lin-15(+)] I. otTi20 [oig-8p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing oig-8p::oig-8 transgene.

kyIs140: [str-2::GFP + lin-15(+)] I. otTi22 [str-1p::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing str-1p::oig-8 transgene.

kyIs140: [str-2::GFP + lin-15(+)] I. otTi24 [ceh-36(prom3)::oig-8 + NeoR]. Single-copy mini-Mos insertion of rescuing ceh-36(prom3)::oig-8 transgene.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-16 allele in daf-2(e1370) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-12 allele. Reference: Aghayeva et al., submitted

Superficially wildtype. GFP tag inserted into endogenous daf-3 locus through CRISPR/Cas9 engineering. Reference: Aghayeva et al., submitted

Superficially wildtype. CRISPR/Cas9-engineered AID conditional daf-3 allele. Reference: Aghayeva et al., submitted

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR] II. Temperature sensitive dauer constitutive. Maintain at 15C. Pharyngeal muscle-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

ieSi61[ges-1p::TIR1::mRuby + unc-119(+)] II. Temperature sensitive dauer constitutive. Maintain at 15C. Intestine-specific depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-3 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

Temperature sensitive dauer constitutive. Maintain at 15C. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background (TIR1-less control). Reference: Aghayeva et al., submitted

ieSi57 [eft-3p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. CRISPR/Cas9-engineered AID conditional daf-12 allele in daf-7(e1372) background with ubiquitous TIR1 expression. Reference: Aghayeva et al., submitted

ieSi60 [myo-2p::TIR1::mRuby + unc-119(+)] II. Maintain at 15C. Temperature-sensitive dauer constitutive. Pharyngeal muscle-specific depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted

otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. Pan-neuronal nuclear GFP expression. pals-22(ot810) mutant shows transgene-silencing phenotype. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.

otIs381 [ric-19p(prom6)::2xNLS::GFP + elt-2::DsRed] V. pals-22(ot811) mutant shows transgene-silencing phenotype. Pan-neuronal nuclear GFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50. Leyva-Díaz E, et al. Genetics (2017), 207(2):529-545.

unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, (2018). BRN3-type POU homeobox genes maintain the identity of mature postmitotic neurons in nematodes and mice. Curr Biol (in press).

otEx7230 [ets-5p::TagRFP + rol-6(su1006)]. Transgene contains 3.25 kb of ets-5 promoter fragment. GFP tag inserted into endogenous inx-6 locus.

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).

ot856 [che-1::SEC-GFP::TEV::3xFLAG]. Endogenous locus of che-1 carrying mutation in regulatory region (ASE motif) and tagged with GFP. che-1 expression, molecular marker expression and neuronal function (chemotaxis assays) severely affected. Reference: Leyva-Díaz E, Hobert O. Transcription factor autoregulation required for acquisition and maintenance of neuronal identity. (Under revision).

otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-16 in the presence of auxin. Reference: Aghayeva et al., submitted

otIs730 [UPN::TIR1::mTur2 + inx-6(prom18)::TagRFP]. Temperature sensitive dauer constitutive. Maintain at 15C. UPN (Ultra Pan-Neuronal) promoter contains four short pan-neuronal promoters fused together (unc-11::rgef-1::ehs-1::ric-19). Panneuronal depletion of DAF-12 in the presence of auxin. Reference: Aghayeva et al., submitted

tagRFP inserted into endogenous che-7 locus.

otIs114 [lim-6p::GFP + rol-6(su1006)]. Loss of lys-12 leads to the disruption of ASEL fate markers and the ectopic expression of ASER cell fate markers in ASEL. otIs114 reporter, normally expressed in ASEL and excretory gland cells, is lost in lsy-12 mutants. Rollers.

ntIs1 [gcy-5p::GFP + lin-15(+)] V. Ectopic expression of ntIs1 in ASEL. Rollers. Whole genome sequenced strain.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.