Search Strains

Superfically wild-type. hsr-9(xoe17) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The hsr-9 repair template (gattttgcctcttaaataaaatttcagCAAAAAACCGAGGGGAGACTTGCAATAGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCTCTCGGATCATCTTGCAAACATGCTTATTGCTGgtaggtattgcaacc) and guide RNA (AGGGGAGACTTGCAATATCT) were injected into N2 and the resulting progeny were analyzed by PCR using TGAAATTAAGGTGGTCACTCGAAG and GTTGTTGTGGGGAGGCTGAA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Superfically wild-type. polq-1(xoe51) was generated by incorporating a stop-in cassette early in the coding region using the co-CRISPR method (Paix et al. 2015). The polq-1 repair template (AGAGAATTCTCTGAAGATCCATTAATATTGCTTACCGAAGGGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAGCTAGCAGAGTTTTCGCCGCAATTCTCAGACTTTGGTAATGATTTC) and guide RNA (ATTGCGGCGAAAACTCTCTT) were injected into N2 and the resulting progeny were analyzed by PCR using ATAGGCAAATGGCTGGACGG and TCAAAGCAGTCTTCTCGGCA. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Emb. Reference: Hariri S, et al. (2023). 53bp1 mutation enhances brca1 and bard1 embryonic lethality in C. elegans. microPublication Biology. 10.17912/micropub.biology.000934. PMID: 37581122.

Phenotypically WT. Isoelectric variant of ges-1 intestinal carboxylesterase.

Heterozygotes are Unc and segregate Uncs, dead eggs, and non-Uncs (dsb-1 homozygotes), which produce 99% inviable embryos due to meiotic nondisjunction. Pick Unc to maintain and check for correct segregation of progeny. we11 is a TCA to TAA nonsense mutation in the dsb-1 coding sequence that introduces a premature stop after leucine 96. Reference: Stamper EL, et al. PLoS Genet. 2013;9(8):e1003679.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi58 is a single copy transgene inserted into chromosome IV (oxTi177) expressing AID*::GFP in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieEx21 [smu-2p::AID*::smu-2::GFP::smu-2 3'UTR + rol-6(su1006)]. Rollers. Pick Rollers to maintain array. Rollers carry a transgene expressing AID*- and GFP- tagged SMU-2 in both the soma and the germ line. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of nuclear protein in various tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi58 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (oxTi177) expressing AID*::GFP in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi59 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. Single copy transgene inserted into chromosome III (oxTi444) expressing AID*::GFP at low levels in the soma. This strain can be combined with different TIR1 strains to test auxin-inducible degradation (AID) of protein in somatic tissue. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. ieSi59 [eft-3p::AID*::GFP::unc-54 3'UTR + Cbr-unc-119(+)] III. ieSi57 is a single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. ieSi59 is a single copy transgene inserted into chromosome III (oxTi444) expressing AID*::GFP at low levels in the soma. This strain can be used as control for auxin-inducible degradation (AID) in somatic tissues. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be combined with different TIR1 strains to examine spatial and temporal requirements for dynein, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. This strain can be used for auxin-inducible degradation (AID) in pharyngeal muscle. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used for auxin-inducible degradation (AID) in the intestine. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in somatic tissue, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in pharyngeal muscle. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in pharyngeal muscle, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the intestine. This strain can be used to examine spatial and temporal requirements for dynein in the intestine, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. An AID*::GFP tag was inserted at the 3' end of the endogenous dhc-1 coding sequence via CRISPR/Cas9. This strain can be used to examine spatial and temporal requirements for dynein in the germ line and early embryos, and to serve as a control strain for auxin-inducible degradation (AID). Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

Degron and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. AID* and GFP tag inserted into endogenous air-2 gene locus by CRISPR/Cas9 engineering allows auxin-inducible degradation (AID) of AIR-2 in germ line and early embryos. Reference: Divekar NS, et al. PLoS Genet. 2021 May 20;17(5):e1009567. PMID: 34014923

ieSi11 [syp-3p::EmeraldGFP::syp-3::syp-3 3'UTR + Cbr-unc-119(+)] II. ieSi11 was inserted into ttTi5605 II using MosSCI. Expression of GFP::SYP-3 largely complements syp-3(ok758), but some meiotic nondisjunction is detected above the N2 background (85% embryonic viability; ~1% male self-progeny;). GFP::SYP-3 expression is readily detected in spermatocytes and oocytes in the germline, and localizes to the interface between paired homologous chromosomes during most of meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.

ieSi21 [sun-1p::sun-1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. ieSi21 was inserted into cxTi10882 IV using MosSCI. Expression of the transgenic SUN-1::mRuby fusion protein complements the sun-1 deletion allele. SUN-1::mRuby is expressed throughout the germline and in the early embryo, where it localizes to nuclear envelope and associates with chromosome pairing centers during early meiotic prophase. Reference: Rog O, Dernburg AF. Cell Rep. 2015 Mar 10. pii: S2211-1247(15)00178-3.

ieSi6 [htp-3p::htp-3::GFP + Cbr-unc-119(+)] II. Maintain at 20C. Although silencing of the transgene has not observed, it may be helpful to maintain it over htp-3(tm3655) to continually select for expression. unc-119(ed3) might not be homozygous in this strain. Reference: Kim et al. Dev Cell. 2015 Oct 26;35(2):247-61.

ieSi21 [sun-1::mRuby] IV. Homozygous animals developed normally, their self-progeny showed reduced viability, and many survivors were males (8%).

ieSi64 [gld-1p::TIR1::mRuby::gld-1 3' UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. Comparing to CA1472, this strain expresses a higher level of TIR1 and can induce a faster degradation of AID-tagged proteins in the germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

ieSi65 [sun-1p::TIR1::sun-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

meIs8 [pie-1p::GFP::cosa-1 + unc-119(+)] II. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. References: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635. Zhang et al., Elife. 2018 Mar 9;7. pii: e30789.

ieSi68 [sun-1p::TIR1::mRuby::htp-1 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing a modified Arabidopsis thaliana TIR1 tagged with mRuby in the germ line and early embryos. This strain can be used for auxin-inducible degradation (AID) in germ line and early embryos. Reference: Zhang L, et al. Development. 2015 Nov 9. pii: dev.129635.

40% XO self progeny. Recessive.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. AID* and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX6035 with CA1200. Reference: Cahoon CK, Libuda DE. Conditional immobilization for live imaging Caenorhabditis elegans using auxin-dependent protein depletion. G3 (Bethesda). 2021 Oct 19;11(11):jkab310. doi: 10.1093/g3journal/jkab310. PMID: 34534266; PMCID: PMC8527506.

Bacteria. This strain of E. coli is easier for worms to eat than other E. coli strains. [supE44 hsdS20(rB-mB-) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1]. Contains a mutation (rpsL20) in a ribosomal subunit gene that confers streptomycin resistance. Biosafety Level: BSL-1.

No obvious phenotype. Chromosomal deletion beginning from -42 bp to +1196 bps relative to elt-4 ATG (+20bp insert).

Partial maternal effect lethal. Lack of PHO-1 acid phosphatase activity on isoelectric focusing gel.

Heterozgyotes are WT and segregate WT, DpyUncs, and Unc Pho (slightly slow growing, about 15% shorter than WT and produce about 60% inviable embryos; early broods are less viable than later broods).

Animals with Dp/+ are WT. Animals which have lost the Dp arrest as L1 with Gob (gut-obstructed) phenotype. Animals with Dp/Dp are sterile homozygotes. gob-1(ca17) is a small deletion, removing nine genes between R03A10.4 and H13N06.4 (inclusive) and possibly the seven additional genes F39D8.2 to R03A10.3 and H13N05.6.

Overall healthy but reduced brood size and pharyngeal pumping rate. Synthetic lethal with emr-1(-). ca19 is a Leu to Arg mutation at position 16 of LEM-2, reconstituting a mutation in the American Hutterite Population that causes juvenile cataracts and premature cardiomyopathy.

Heterozygotes are WT and segregate WT, Lon males and dead eggs.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.