Search Strains

More Fields See WormTagDB for other published tagged loci.
Strain Species Genotype Add
NK741 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. Show Description
qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
NK742 C. elegans rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. Show Description
qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
NL2098 C. elegans rrf-1(pk1417) I. Show Description
Homozygous rrf-1 deletion allele. RNAi interference for genes expressed in somatic tissue is lost in rrf-1 deletion mutants.
NL2099 C. elegans rrf-3(pk1426) II. Show Description
Homozygous rrf-3 deletion allele. Increased sensitivity to RNAi when compared to WT animals. Deletion sequence (deletion in lower case letters, flanking undeleted sequence in capital letters): TGCACATATTctacagaatt ------- --------tacccgattaAATGGACAATT (from Plasterk Lab 11/05).
NL2808 C. elegans pxf-1(pk1331)/dpy-20(e1363) IV. Show Description
Pick WT to maintain. The pk1331 allele can be followed by PCR.
NL3223 C. elegans nxf-1(pk386) V. Show Description
Suppressor of activated Gs. Temperature sensitive allele.
NL4005 C. elegans nxf-1(pk864) V. Show Description
Suppressor of activated Gs. Temperature sensitive allele.
NM1278 C. elegans rbf-1(js232) III. Show Description
Lethargic in the absence of stimulation. 1500 bp deletion including the promoter and first three exons of C. elegans rabphilin homolog.
NM3159 C. elegans jsIs423. Show Description
jsIs423 [rbf-1::GFP + rol-6(su1006)]. Rollers. Maintain under normal conditions. Reference: Mahoney TR., et al. Mol Biol Cell. 2006 Jun;17(6):2617-25.
NOB142 C. elegans daf-2(e1370) III; isp-1(qm150) IV/nT1[qIs51] (IV;V). Show Description
Maintain at 15-20C: will form dauers at higher temps. Slow growing. Pick GFP+ to maintain. Heterozygotes are GFP+ and segregate WT GFP+ hets, arrested nT1[qIs51] aneuploids, and non-GFP daf-2(e1370); isp-1(qm150) homozygotes (sterile). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. [NOTE: Originally published daf-2(e1370); isp-1(qm150) strain MQ876 was found to not actually contain the daf-2(e1370) mutation. This strain was made to study the double mutant and revealed that daf-2(e1370); isp-1(qm150) homozygotes are inviable/sterile.] Reference: Cooper et al. In preparation.
NS2937 C. elegans trf-1(nr2014) III. Show Description
No obvious phenotype.
NU1 C. elegans bra-1(nk1) X. Show Description
Head-lifting phenotype. Weak suppressor of Daf-c.
NU3 C. elegans dbl-1(nk3) V. Show Description
Previously called cet-1(kk3). Short, somewhat Dpy. Males have crumpled spicules and abnormal rays; Similar to sma-2, sma-3, sma-4, sma-6 and daf-4.
NW424 C. elegans unc-76(ev424) V. Show Description
Unc. Loss-of-function or null allele.
OD2174 C. elegans unc-119(ed3) III; mdf-2(lt4::loxP::Cbr-unc-119(+)::loxP) IV/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD2442 C. elegans ltSi794 II; unc-119(ed3) III. Show Description
ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
OD2768 C. elegans ltSi910 II; unc-119(ed3) III. Show Description
ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2770 C. elegans ltSi912 II; unc-119(ed3) III. Show Description
ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2772 C. elegans ltSi914 II; unc-119(ed3) III. Show Description
ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al.  Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2773 C. elegans ltSi915 II; unc-119(ed3) III. Show Description
ltSi915 [osm-6p::zif-1::operon-linker::mCherry::histone::tbb-2 3'UTR + Cbr-unc-119(+)] II. This strain provides a sensory neuron-specific source of ZIF-1 alone and serves as a control strain for OD2772, which mediates ciliated sensory neuron-specific degradation of GFP-tagged proteins. It can also be used as source of sensory-specific ZIF-1 for other applications. Superficially wild type. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.
OD2906 C. elegans mdf-1(lt39[mNG::tev::loxP::3xFlag::mdf-1]) V. Show Description
mNeonGreen and Flag tags inserted at 5' end of endogenous mdf-1 locus using CRISPR/Cas9 engineering. gRNA sequence: tgattgcattaaacatatt Reference: Kim T, et al. Genes Dev. 2017 Jun 1;31(11):1089-1094. doi: 10.1101/gad.302067.117. PMID: 28698300.
OD2984 C. elegans ltSi953 II; unc-119(ed3) III. Show Description
ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398
OD3737 C. elegans cyb-3(lt110) V/nT1 [qIs51] (IV;V). Show Description
CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.
OD4376 C. elegans mdf-1(lt167[mScarlet::tev::loxP::3xFlag::mdf-1])V. Show Description
CRISPR/Cas9 engineered. Tagged MDF-1 at its endogenous locus with mScarlet. gRNA sequence: tgattgcattaaacatatt Reference: Lara-Gonzalez P, et al. Science. 2021 Jan 1;371(6524):64-67. doi: 10.1126/science.abc1424. PMID: 33384372.
OE3001 C. elegans him-8(e1489) IV; dyf-4(m158) V. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Throws males.
OE3002 C. elegans him-8(e1489) IV; xbx-1(ok279) V. Show Description
Dyf. Osm. Throws males. Reduced mating efficiency (ME 2-3). Deletion extends over 1610 bp in the intron between exons 3 and 4 and ending 30 bp after the STOP codon (cosmid F02D8 pb 25954-27563 are deleted). Complements dyf-4(m158).
OE3035 C. elegans daf-19(sa232) II. Show Description
Daf-c. Dyf. Maintain at 15C.
OE3059 C. elegans daf-19(rh1024) II. Show Description
Daf-c. Dyf. Maintain at 15C.
OE3063 C. elegans daf-19(m86) II. Show Description
Daf-c. Dyf. Maintain at 15C.
OG153 C. elegans unc-119(ed3) III; drEx206. Show Description
drEx206 [hsf-1p::hsf-1::YFP::unc-54 3'UTR + unc-119(+)]. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG496 C. elegans drSi12 II; unc-119(ed3) III. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+) II. Human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules only after prolonged (1 hr) 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG497 C. elegans drSi13 II; unc-119(ed3) III. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules after >1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG528 C. elegans hsf-1(sy441) I; drSi12 II. Show Description
drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG532 C. elegans hsf-1(sy441) I; drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy C. elegans HSF-1 (drSi13) in hsf-1(sy441) hypomorph. drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG566 C. elegans drSi28 II; unc-119(ed3) III. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules at a reduced rate compared to wild type immediately after 1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG575 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi13 II. Show Description
drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG576 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT GFP+ heterozygotes, larval-arrested ok600 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. [NOTE: Although ok600 has been reported as a 1085 bp deletion in hsf-1, sequencing of the hsf-1 PCR product revealed only an 877 bp deletion (5'-AAATAAAAATTTCTTAGAAA [877 bp deletion] TGTACATGGGATCCGGTCCA-3'). (Lamitina Lab, 12/17/2012)]
OG580 C. elegans hsf-1(sy441) I; drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG584 C. elegans hsf-1(ok600) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); drSi28 II. Show Description
drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG636 C. elegans drSi41 II; unc-119(ed3) III. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OG646 C. elegans hsf-1(sy441) I; drSi41 II. Show Description
drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.
OH110 C. elegans lim-6(nr2073) X. Show Description
Egl. Exp. Syn daf-c. 1.7 kb deletion in lim-6 locus.
OH11319 C. elegans otIs412 X. Show Description
otIs412 [unc-3p::GFP + rgef-1p::DsRed] X. GFP expression in DA/DB/VA/VB class neurons. Reference: Kerk SY, et al. Neuron 2017 (in press).
OH11410 C. elegans pha-1(e2123) III; otEx5173. Show Description
otEx5173 [nsf-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH11744 C. elegans otIs445; gwIs39. Show Description
otis445 [ace-2p::RFP + LacO repeats]. gwIs39 [baf-1p::GFP::lacI::let-858 3'UTR + vit-5p::GFP]. RFP expression in cholinergic motor neurons. LACI::GFP aggregates on LacO repeats to form two dots in every nucleus. vit-5::GFP is expressed in intestine at L4 stage and later. Reference: Patel T & Hobert O. eLife 2017.
OH12867 C. elegans pha-1(e2123) III; otEx5904. Show Description
otEx5904 [rgef-1(fosmid)::SL2::NLS::YFP::H2B + pha-1(+)]. Maintain at 25C to select for array. Pan-neuronal nuclear YFP expression. Reference: Stefanakis N., Carrera I., Hobert O. Neuron. 2015 Aug 19;87(4):733-50.
OH13027 C. elegans otIs569. Show Description
otIs569 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)]. Reporter tag inserted into fosmid WRM064dH02. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13107 C. elegans otIs570 I; him-5(e1490) V. Show Description
otIs570 [snf-11(fosmid)::SL2::H2B::mChopti + pha-1(+)] I. Reporter tag inserted into fosmid WRM064dH02. Him. Line 14-1. Reference: Gendrel M, et al. Elife. 2016 Oct 14;5.
OH13908 C. elegans daf-16(ot821[daf-16::mKate2::3xFLAG]) I. Show Description
CRISPR allele of daf-16, tagged at the C-terminus with mKate2::3xFLAG. Reference: Aghayeva U, et al. A panel of fluorophore-tagged daf-16 alleles. microPublication Biology.
OH14125 C. elegans daf-16(ot853[daf-16::linker::mNeonGreen::3xFlag::AID*]) I. Show Description
mNeonGreen tag inserted into endogenous daf-16 locus; AID* at 3' end of mNeonGreen. Transgene can be degraded in a background expressing TIR1 co-factor and supplemented with auxin, allowing conditional knock-down of daf-16 expression. Reference: Bhattacharya et al. Cell. 2019 Feb 21;176(5):1174-1189.e16. PMID: 30686580