Search Strains

GFP tag inserted into N-terminus of endogenous syd-2 locus with (517-836) region deleted. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

GFP tag inserted into N-terminus of endogenous elks-1 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into N-terminus of endogenous syd-2 locus with (517-836) region deleted. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

CRISPR/Cas9-engineered deletion of endogenous SYD-2(517-836) region. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

elks-1(wy1397) is a CRISPR-engineered deletion of ELKS-1(301-3350), ELKS-1(716-775), and ELKS-1(807-836). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. FLPon::mScarlet-I tag inserted into endogenous unc-10 locus. syd-2(wy1292) is a CRISPR-engineered deletion of SYD-2(517-836). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

syd-2(wy1414) is a CRISPR-engineered deletion of SYD-2(517-539), SYD-2(617-655), and SYD-2(731-801). Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. apa-2(ox422) is a loss of function point mutation. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. mec-4(e1611) is a gain of function point mutation. wyIs740 [ser-2(prom3)::dma-1::GFP + odr-1p::GFP] IV. GFP inserted into DMA-1 after transmembrane region and before cytoplasmic tail in wyIs740 reporter. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. mec-4(e1611) is a gain of function point mutation. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. gk8 is a punitive null allele of kpc-1. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

mNeonGreen::AID*::3xFLAG tag inserted at C-terminus of endogenous unk-1 locus. Reference: Gitler L, et al. MicroPubl Biol. 2025 Jun 11;2025:10.17912/micropub.biology.001659. doi: 10.17912/micropub.biology.001659. PMID: 40575442.

tmIs905 [dat-1p::alpha-synuclein(A30P) + ges-1p::DsRed] II. egIs1 [dat-1p::GFP]; reportedly maps to LG IV. hrpr-1 also known as hrp-2. yyz8 is a weak loss-of-function allele. Neurodegeneration in ADE neurons. Neurites are shorter in PDE neurons.

teIs113 [pie-1p::GFP::H2B::zif-13'UTR 771bp + unc-119(+)]. A 771 bp genomic sequence downstream of the zif-1 stop codon (starting immediately after the stop codon) was cloned downstream of pie-1 promoter-driven GFP::H2B in the germline expression vector pID3.01B. Superficially wild-type. Reference: Oldenbroek M, et al. Dev Biol. 2012 Mar 15;363(2):388-98.

teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.

Dominant suppressor of zu405. Putative oma-1 null. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].

Heterozygotes are Unc and segregate Unc and non-Unc steriles (oma-1; oma-2 homozygotes). The Oma animal has an empty uterus and lots of oocytes in the gonad arms. Maintain by picking Uncs. zu405 is a gain-of-function mutation which results in temperature sensitive, embryonic lethality. Loss-of-function mutation in either oma-1 or oma-2 alone does not have a detectable phenotype. te33 is a dominant suppressor of the zu405 embryonic lethality. te51 is a mutation that, in the oma-1(zu405te33) background, gives an Oma (Ooctye Maturation defective) phenotype. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].

teIs65 [pie-1p::GFP::plk-1(PBD) + unc-119(+)] II. Maintain at 25 degrees and by picking the most brightly fluorescing animals to avoid silencing of the transgene. teIs65 contains GFP fused to the PLK-1 protein-binding domain. Derived from injection of pRL1216. Reference: Nishi Y, et al. Development. 2008 Feb;135(4):687-97.

yIs2 [xol-1::lacZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.

yIs2 [xol-1::laxZ + rol-6(su1006)] IV. Rollers. XO-specific expression of lacZ fusion.

Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).

Animals heterozygous for yDp4 are Dpy non-Flu non-Unc. Animals which have lost yDp4 are FluUnc. Animals homozygous for yDp4 are dead (embryonic lethal). Low percentage of non-Dpy non-Unc progeny. These give a high percentage of Unc male self-progeny and are inferred to be yDp4 XO hermaphrodites.

Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.

meDf6; yDp13 is WT hermaphrodite which is Him. 27% of self-progeny are WT males. yDp13 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain by picking L4 hermaphrodites and checking to make sure they give lots of dead eggs and lots of males. [yDp13 XO males with an intact X chromosome are >90% inviable.]

meDf6; yDp15 is WT hermaphrodite which is Him. 23% of self-progeny are WT males. yDp15 recombines with X, but such recombination is greatly reduced in an meDf6 background. Maintain strain by picking L4 hermaphrodites and making sure they give lots of dead eggs and lots of males. [yDp15 XO males with an intact X chromosome are >90% inviable.]

WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.

yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion.

yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll.

Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains.

Dpy. Throws males. Pick L4 hermaphrodites to maintain. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32. TY3936 was derived in 2002 from TY1932 ncl-1(e1865) unc-36(e251); dpy-21(e428) X N2; cloned WT progeny, let self and picked Dpy animals, cloned and selfed, looked for absence of Unc progeny. TY1932 was frozen into TY collection in 1993; built from other strains derived original CB428 stock obtained & frozen in 1983.

Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF, et al. Genes Dev. 2009 Aug 1;23(15):1763-78.

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

Fully penetrant XO lethal. XX is WT. Enhancer of her-1(sd), tra-2(lf), tra-3(lf) XX masculinization phenotypes. Does not enhance tra-1(lf).

Heterozygotes are WT with pharyngeal GFP, and segregate GFP+ heterozygotes, non-GFP homozygotes, and inviable nT1[qIs51] aneuploid embryos. Homozygous progeny of heterozygous mothers are viable, but produce mostly dead embryos. Reference: Severson AF & Meyer BJ. 2014. eLife. 2014 Aug 29;3:e03467.

syIs44 [hsp-16p::lacI::GFP + lacO(256) + dpy-20(+)] V. Heatshock induces expression of lacI::GFP in the soma, which binds to integrated lacO arrays. lacI::GFP expression is silenced in the germline. Derived by out-crossing PS2442 to remove e1282. Reference: Severson AF & Meyer BJ. Elife. 2014 Aug 29;3:e03467.

Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93.

Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y59) is a nonsense mutation predicted to terminate translation at codon 417, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.

Male lethal. y684 is s a null allele caused by precise deletion of the coding sequence of xol-1. Reference: Anderson EC, et al. Dev Cell. 2019 Oct 21;51(2):192-207.e6.

Heterozygotes are WT and segregate WT, Lon males, and dead eggs. sdc-2(y74)/sdc-2(y74) is lethal, although about 3% of the animals escape the lethality. These animals are extremely Dpy, extensively masculinized, and never fertile.

Point mutation at amino acid position 130 of rap-1 (aaaagatCagc -> aaaagatTagc).

baIs4 [dat-1p::GFP + dat-1p::CAT-2]. GFP expression in CEP, ADE and PDE neurons. From integration of baEx33.

rab-5 [D135D]. Silent BstAPI site added in D135D allele for ease of genotyping. Balancer marked with myo-2p::Venus. Reference: Huang et al. 2022. PMID: 35121658

rab-5 [Q78Q]/tmC18 I. Control edit mutation maintained over tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5 [Q78Q] homozygotes (viable and fertile), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. NOTE: udn15 is essentially wild-type. Pick Venus+ to prevent non-Venus rab-5 [Q78Q] homozygotes from taking over the population and losing the balancer! Silent KpnI site added in Q78Q allele for ease of genotyping. Reference: Huang et al. 2022. PMID: 35121658

Variant edit allele, G1514R. SpeI restriction site created by synonymous changes for ease of genotyping.

Control edit allele, G1514G. SpeI restriction site created by synonymous changes for ease of genotyping.

let-413 [L248L]. Control edit. ApoI-HF restriction site created by synonymous changes for ease of genotyping. Wild-type looking.

let-413 [L248P]. Variant edit. Homozygous lethal or sterile deletion balanced by tmC3. Heterozygotes are wild-type mCherry+ and segregate mCherry+ heterozygotes, udn27 homozygotes (arrest stage unknown), and mCherry+ tmC3 homozygotes (Unc-23 Lon-3). Pick viable fertile mCherry+ animals to maintain. ApoI-HF restriction site created by synonymous changes for ease of genotyping.