Search Strains

ddIs123 [his-63::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs128 [ify-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs129 [klp-4::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs137 [hcp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs68 [bub-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs145 [klp-7::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddEx291 [his-24::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs151 [mdf-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs153 [knl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs159 [arx-2::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs6 [tbg-1::GFP + unc-119(+)]. ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. unc-119(ed3) mutation might have been lost during crossing of TH27 and AZ212.

Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.

Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.

ddIs193 [rabs-5::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs254 [ctbp-1::2xTY1::GFP:: FRT::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs262 [mes-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs263 [eat-4::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddEx69 [brd-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Maintain by picking wild-type (non-Unc) animals. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs268 [rad-51::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs290 [sax-7::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

ddIs297 [brd-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Mean lifespan 12.3 days. Carries Ts of BergBO. Carries Daf+ of N2. Males fertile. One of the shortest lived strains. No fertility at 25C.

Life span typically abut 20 days. Ts+ allele of N2. Daf allele of BergBO. Not male fertile.

Life span typically about 25 days. Carries Ts+ locus of N2. Carries Daf locus of BergBO. Males fertile.

Typical life span about 33 days. Carries Ts+ locus of N2 and Daf locus of BergBO. Males fertile.

zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.

Temperature sensitive sperm defect, grow at 15C. Long life (1.7X N2 is typical). Low brood size (15% of N2 is typical).

Long life (1.7X greater than N2). Low brood size (10% of N2). Temperature sensitive sperm defect; grow at 15C. WT.

zdIs5 [mec-4p::GFP + lin-15(+)] I. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6.

texIs127 [spp-9p::GFP] X. GFP expression in intestine and six aphid neurons, including AWB and AWC, serves as a reporter for DBL-1 signaling (fluorescence is high when DBL-1 signaling is low, and low when DBL-1 signaling is high). This reporter is also responsive to starvation, select bacterial pathogens, and loss of other innate immune signaling pathways, including tir-1 and pmk-1 (but not sek-1 or mek-1). texIs127 created by X-ray integration of extrachromosomal array wkEx52 into N2 animals using UV/TMP. Out-crossed five times to the N2. References: Lakdawala ML, et al. Mol Biol Cell. 2019 Dec 15;30(26):3151-3160. doi: 10.1091/mbc.E19-09-0500. PMID: 31693440. Roberts AF, et al. 2010 Jun 7:10:61. doi: 10.1186/1471-213X-10-61. PMID: 20529267.

High frequency of dauer formation under hyperoxia (90% oxygen) at 20C. Reference: Honda Y, Tanaka M, Honda S, (2008) Exp Gerontol 43:520-9.

mikSi1 [sas-4p::dendra2::sas-4] inserted into ttTi5605 II. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Photoconvertable tagged SAS-4 protein. Reference: Erpf AC & Mikeladze-Dvali T. (2020). Tracking of centriole inheritance in C. elegans. microPublication Biology. 10.17912/micropub.biology.000256.

Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).

Slow growth, Slow movement. T09F3.2 encodes a homolog of human mitochondrial pyrimidine nucleotide transporter. ogr2 is a 718 bp deletion; flanking sequences: gagtcggaagttctaattccaaatt - atcagtctaaatatcatttttcttctt

aatIs3 [unc-17p::YC3.60]. Expression of YC3.60 in VA, DA, VB, DB, AS, VC, and other head and tail neurons. Reference: Haspel et al. J Neurosci. 2010 Aug 18;30(33):11151-6.

Defective phototaxis (light avoidance). To identify lite-1(xu7) homozygotes, place day 1 adults on a freshly seeded NGM plate with a thin lawn of OP50. Deliver 2 second pulses of short wavelength light (UV, purple, blue) from an arc lamp to the head of a worm that is slowly moving forward through a 5-10x objective lens in conjunction with a room lens under a fluorescent dissection scope. Manually move the plate so only the anterior of the worm appears in the field of view. Wild-type worms respond by initiating reversals while homozygous mutants do not. Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.

Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.

Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.

A wild type C. elegans virtually indistinguishable from N2. Males mate with high efficiency, unlike Bergerac. High copy number of Tc1 elements. Active for Tc1 transposition and excision. Not temperature sensitive for growth (unlike Bergerac). See also WBPaper00001053 and WBG 10(2) 140-141 and 11(5) 60. Collected from soil in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern HCD).

Recessive gain-of-function. Codon 393 changed from alanine (GCT) to threonine (ACT). Deg and Tab at all temperatures. Lethal at 15C (embryos arrest at the two-fold stage, larvae survive).

Slightly Unc. Few degenerations seen. des-2(u695) is a recessive suppressor of the dominant Unc Deg mutation deg-3(u662).

Abnormal migration of AVM and PVM cells.

uIs46 [rde-1p::mec-2(intron9)::rde-1) + ceh-22::GFP]. Temperature sensitive; maintain at 15 C. RNAi-sensitive at 15 C. Mechanosensory abnormal at 25 C. Uses the ninth intron of mec-2, whose splicing depends on mec-8, to produce temperature-sensitive expression and temperature-sensitive RNAi. Reference: Calixto et al. (2010) Nature Methods 7:407-11.

Touch insensitive-at the tail. Degeneration of a small set of neurons. TAB Touch ABnormal).

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. nj48 is a punitive null allele of sax-7. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. dma-1(wy908) is a partial loss of function allele generated by CRISPR/Cas9-induced frame shift with multiple premature stop codons (n=6, 8 bp deletion). Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs813 [unc-86p::GFP::tba-1 + unc-86p:mCherry::PLCdP]. tba-1(ok1135) is a 1036 bp deletion. Strong expression of GFP::TBA-1 signal, low mCherry::PLCdP signal. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. mec-3(e1338) is a loss of function mutation. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.