Strain Information
| Name | TY3579 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | sea-1(y356) II. |
| Description | Wild type phenotype. In order to identify the correct genotype, JRP93 catttgtctagaactgtcattctgtc; and JRP106 gatctccatttgccggcaaattctcc primers are used to produce a 486 bp amplicon that can be sequenced with either primer for confirmation of the sea-1(y356) lesion (C to T at +97). The sea-1(y356) mutation is covered by the balancer mIn1[dpy-10(e128) mIs14], which is often used in construction of sea-1(y356) containing strains. |
| Mutagen | EMS |
| Outcrossed | x>8 |
| Made by | Jennifer Powell |
| Laboratory | TY |
Sign in
or
register an account if you want to order this strain.