More Fields
Strain Species Genotype
KY47 C. elegans aex-1(tg47) I. Show Description
aBoc and Exp defective. Constipated.
NK2477 C. elegans ptp-3(qy47[ptp-3::mNG+loxP]) II. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.
TY418 C. elegans dpy-21(y47) V. Show Description
Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.
BC10588 C. elegans dpy-5(e907) I; sIs10126. Show Description
sIs10126 [rCes Y47G6A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC10640 C. elegans dpy-5(e907) I; sEx10640. Show Description
sEx10640 [rCesY47H9C.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11886 C. elegans dpy-5(e907) I; sEx11886. Show Description
sEx11886 [rCesY47D3A.25::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11897 C. elegans dpy-5(e907) I; sEx11897. Show Description
sEx11897 [rCesY47D3A.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12051 C. elegans dpy-5(e907) I; sEx12051. Show Description
sEx12051 [rCes Y47D3A.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC12225 C. elegans dpy-5(e907) I; sEx12225. Show Description
sEx12225 [rCesY47D3A.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC14514 C. elegans dpy-5(e907) I; sEx14514. Show Description
sEx14514 [rCes Y47G6A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15776 C. elegans dpy-5(e907) I; sEx15776. Show Description
sEx15776 [rCes Y47A7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC15868 C. elegans dpy-5(e907) I; sEx15868. Show Description
sEx15868 [rCesY47G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
CB7171 C. elegans tra-1(e1099) subs-4(e3026) III; eDp6 (III;f). Show Description
Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).
FX19120 C. elegans atm-1(tm5027) Y47G6A.28(tm7889) nepr-1(tm7890) I; C18H9.6(tm7891) II; xpc-1(tm3886) tmIn21 IV; srh-54(tm7892) V. Show Description
tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV.  Inversion strain obtained by Next-generation sequencing.
RB1044 C. elegans Y47H9C.2(ok990) I. Show Description
Y47H9C.2. Homozygous. Outer Left Sequence: GAGTGAGTTGGTAGCTCCGC. Outer Right Sequence: TGGTGCATCGATCGAAATTA. Inner Left Sequence: GCCACGTGTCGATAACATTG. Inner Right Sequence: CCATGAATCTTTGACGGCTT. Inner Primer PCR Length: 2844 bp. Deletion Size: 890 bp. Deletion left flank: GGTGCGGTCCACGGCTGGTCCCTATATATT. Deletion right flank: ACTATAACAAAAAGAAAACAAATACATTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1117 C. elegans Y47G6A.14(ok1106) I. Show Description
Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1206 C. elegans rsks-1(ok1255) III. Show Description
Y47D3A.16 Homozygous. Outer Left Sequence: gagatgcggaagctatgctc. Outer Right Sequence: gttgaattcctgctcctcca. Inner Left Sequence: attcaactgtgtgccagtgc. Inner Right Sequence: tggggcttcactatttggtc. Inner Primer PCR Length: 3267. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1450 C. elegans csp-3(ok1653) I. Show Description
Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1784 C. elegans dnj-27(ok2302) I. Show Description
Y47H9C.5 Homozygous. Outer Left Sequence: aaatctccaatggatgctcg. Outer Right Sequence: accatggagcaaagaaatcg. Inner Left Sequence: gccggtgtgtcataaggatt. Inner Right Sequence: atccatggttccgatgagtc. Inner Primer PCR Length: 3121. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB1929 C. elegans inx-21(ok2524) I. Show Description
Y47G6A.1. Homozygous. Outer Left Sequence: AAAGTGGCACCGAGAAGTTG. Outer Right Sequence: TCAACGAACTCGAATCATCG. Inner Left Sequence: CTCGCCTCAAAACCAATGTT. Inner Right Sequence: CGTCGATACTGTGGAACGAG. Inner Primer PCR Length: 3086 bp. Deletion Size: 1960 bp. Deletion left flank: ATATTATGGGGACGCAGAAAAATTCGCATT. Deletion right flank: CTAATTTTGTTTATATTGATGAGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2018 C. elegans grl-5(ok2671) V. Show Description
Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 624 bp. Deletion left flank: ATTAATGTCAATCAGGCTTTCAAGTCAAGG. Deletion right flank: AATCACACTGTTACAAGAGTACAGAAAGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2042 C. elegans grl-5(ok2700) V. Show Description
Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 365 bp. Deletion left flank: AGAAATTATTAGTTCAAAAGTACACCAGTC. Deletion right flank: AACTCCAGTGTCAATATCCATAACATCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2289 C. elegans wht-8(ok3112) III. Show Description
Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2378 C. elegans msh-6(ok3231) I. Show Description
Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2424 C. elegans Y47D3A.1(ok3330) III. Show Description
Y47D3A.1 Homozygous. Outer Left Sequence: ccactttcctgattcccaga. Outer Right Sequence: agccaacgttcgaaacaaac. Inner Left Sequence: gacgttgatggctccatttt. Inner Right Sequence: cccactttacatggtttggg. Inner Primer PCR Length: 1248. Deletion size: about 250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2444 C. elegans Y47G6A.3(ok3367) I. Show Description
Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RG3162 C. elegans Y47G6A.18(ve662[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/hT1 Show Description
umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RG3163 C. elegans Y47G6A.19(ve663[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I. Show Description
Homozygous viable. Deletion of 3949 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaaatccaaaaaaaactcacCGGCAAATA ; Right flanking sequence: GTCAGCTCGATCCGTGTCAGCTGTCTCGAA. sgRNA #1: aaaactcacCGGCAAATATT; sgRNA #2: ACACGGATCGAGCTGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
RW12268 C. elegans Y47G6A.7(st12268[Y47G6A.7::TY1::eGFP::3xFLAG]) I. Show Description
eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.
SL438 C. elegans spe-9(eb19) I; him-5(e1490) V; ebEx126. Show Description
ebEx126 [YAC Y47H9 [spe-9(+)] + rol-6(su1006)]. Pick Rollers to maintain. eb19 is a spe-9 non-conditional mutant.
VC1044 C. elegans gly-9(gk440) III. Show Description
Y47D3A.23a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1128 C. elegans mis-12&Y47G6A.25(ok1536)/szT1 [lon-2(e678)] I; +/szT1 X. Show Description
Y47G6A.24, Y47G6A.25. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1245 C. elegans smc-3(ok1703) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1250 C. elegans pcaf-1(ok1690) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1807 C. elegans nhr-118&Y47D7A.3(gk811) V. Show Description
F13A2.8, Y47D7A.3. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1042 bp. Deletion left flank: AGTCGATTTATTCCTGACCCAAGTGGTATA. Deletion right flank: GCATCCCTTGTTCCATCTCCAAAATTGTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1878 C. elegans lpd-3(ok2138) I. Show Description
Y47G6A.23. External left primer: AAGAAGCTGCTGGCCAATAA. External right primer: TGGAACTCTTCCAATTTCCG. Internal left primer: TGTTTCGGTCTAAACGAGGC. Internal right primer: TCAGTGAAGTGGCGATTGAG. Internal WT amplicon: 3251 bp. Deletion size: 1913 bp. Deletion left flank: GACTGTTGGGTTACTGTAGTGGTATTGTGG. Deletion right flank: AGTACCCTTTAAAGGTGCACGCCTTTTTTC. Insertion Sequence: GAGTAATTCTTTTTTTTTCGCGTAGCCAACAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1886 C. elegans sbp-1(ok2363) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1970 C. elegans gkDf42 gkDf43 I; Y47D3B(gk1197) III. Show Description
This strain is homozygous for a deletion (gk1197) in Y47D3B, detectable by PCR using the following primers. External left primer: AAACGCGAAAATGTCGAAAC. External right primer: GATGTCTTCTCCCCCTCCTC. Internal left primer: GCGTCAAATATGTCGCGTAA. Internal right primer: TTAGTAGGCGGCTTTGTGGT. Internal WT amplicon: 1949 bp. Deletion size: 233 bp. Deletion left flank: ACCCCTGGACGTTTGGGCGCGTTTTTGTCA. Deletion right flank: TTTTCAGATAGTACACACACACATAGGAAA. Validation: No CGH probes for gk1197. Other deletions (gkDf42, gkDf43) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC1979 C. elegans R12B2.3(gk3268) R12B2.2(gk3269) tbx-34(gk1051) III. Show Description
This strain is homozygous for a deletion (gk1051) in Y47D3A.10, detectable by PCR using the following primers. External left primer: AGTTGTGGCTTCTGCGAACT. External right primer: CACCCACTGACACCATTGAG. Internal left primer: ATGGTCAGGACGGGAATGTA. Internal right primer: TTTCTCCACTGCAACGTGAC. Internal WT amplicon: 2318 bp. Deletion size: 971 bp. Deletion left flank: TTTTTGTGCAGCAATTTTTGCGGCGGCTGA. Deletion right flank: GGTGTCAGTGAATGTAGGCAGCCATGAAGC. Validation: gk1051 passed by diagnostic PCR, CGH. Other deletions (gk3268, gk3269) identified by CGH. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2263 C. elegans Y47D3B.6(ok3027) III. Show Description
Y47D3B.6. External left primer: CCTCCAAACAAGGCAACATT. External right primer: TGATTTTTCTTGAAAGCCCG. Internal left primer: CCATTGCGATTCACACTCAG. Internal right primer: TTGGGTTTTGTTTTGGGG. Internal WT amplicon: 1120 bp. Deletion size: 558 bp. Deletion left flank: GATGATGGCTCCACCAGCACCACTCCCAGC. Deletion right flank: AGTCTGCCAGTGCGCCGGAGCCTACGAGCC. Insertion Sequence: CTCCC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2677 C. elegans Y47G6A.5(gk1098) I. Show Description
Y47G6A.5. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 720 bp. Deletion left flank: CTCCACCACTTCGTCCGTCTACACAATCAG. Deletion right flank: CATCATATCCTACGCGCAATTTTCAAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC2678 C. elegans Y47G6A.5(gk1100) I; meg-1&K02B9.3(gk1205) X. Show Description
Y47G6A.5, K02B9.1, K02B9.3. External left primer: TAGGGAATATCGATCGGCTG. External right primer: CGCGTCAATCATGGTGTATC. Internal left primer: TTCAACTACCGTAGCCGAGG. Internal right primer: GATCCGAAATGAATAACCGC. Internal WT amplicon: 1768 bp. Deletion size: 371 bp. Deletion left flank: TAACATTTCGCGGCATCCATCAGCAACTTC. Deletion right flank: GCAACTTTTTCAAAATTAAAAAAAAACAGT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC275 C. elegans nefr-1(ok471) I. Show Description
Y47G6A.28. Mildly Unc, lethargic. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807. nefr-1 formerly known as tag-63.
YY470 C. elegans dcr-1(mg375) III. Show Description
Enhanced RNAi response. Sterile at 25 C. Outcrossed from YY11; wild-type for mut-16. Superficially wild-type.