aBoc and Exp defective. Constipated.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.

Isolated as a suppressor of xol-1(y9). Dpy. Throws males. Pick L4 hermaphrodites to maintain. dpy- 21(y47) is a nonsense mutation predicted to terminate translation at codon 1396, and can be suppressed by the amber suppressor sup-7. Reference: Yonker SA & Meyer BJ. Development. 2003 Dec;130(26):6519-32.

sIs10126 [rCes Y47G6A.7::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx10640 [rCesY47H9C.5::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11886 [rCesY47D3A.25::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx11897 [rCesY47D3A.6a::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12051 [rCes Y47D3A.6b::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx12225 [rCesY47D3A.11::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx14514 [rCes Y47G6A.6::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15776 [rCes Y47A7.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

sEx15868 [rCesY47G7B.1::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).

Pick wild-type to maintain. Wild-type hermaphrodites segregate wild-type and dead masculinized embryos. e3026 is nonsense mutation in essential gene Y47D3B.1. Reference: O'Rourke et al (in preparation).

tmIn21 is an inversion between pck-3 and R09H10.5 in LG IV.  Inversion strain obtained by Next-generation sequencing.

q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1023 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2. Derived by modification of parental strain JK5935 fbf-2(q945[3xFLAG::fbf-2]) II. Pick GFP+ t maintain. Homozygous sterile (Mog) mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok91 q1023 homozygotes (sterile Mog). Pick WT dim GFP and check for correct segregation of progeny to maintain. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

q1080 is an engineered insertion of LambdaN peptide near the C-terminus of 3xFLAG-tagged FBF-2 with a Y479A point mutation in the R7/R8 loop. Derived by modification of parental strain JK5984 fbf-2(q1011[*q945]) II. Reference: Carrick BH, et al. Dev Cell. 2024 Mar 11;59(5):661-675.e7. doi: 10.1016/j.devcel.2024.01.005. PMID: 38290520.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes. fbf-1(q1227) fbf-2(q945[3xFLAG::fbf-2]) homozygotes are partially sterile, ~50% make excess sperm and delay oogenesis resulting in delayed egg laying when compared to wild-type animals. Pick WT dim GFP and check for correct segregation of progeny to maintain. q1227 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5810.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1011 is an engineered Y479A point mutation in the R7/R8 loop of 3xFLAG-tagged FBF-2 derived by modification of parental strain JK5810 fbf-2(q945[3xFLAG::fbf-2]) II. q1228 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK5984.

Pick wild-type GFP+ to maintain. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. q1250 is an engineered Y477A point mutation in FBF-1 derived by modification of parental strain JK3101.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H326A, Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered (H453A H454A E457A Y479A) substitutions. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-1 fbf-2 homozygotes (Sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479F substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

Pick wild-type GFP+ to maintain. 3xFlag tag inserted into endogenous fbf-2 locus with engineered Y479E substitution. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ (heterozygotes), Dpy bright GFP+ (mIn1 homozygotes), and non-GFP fbf-2 homozygotes (sterile?). Pick WT dim GFP and check for correct segregation of progeny to maintain.

3xFlag tag inserted into endogenous fbf-2 locus with engineered (S453A H454A E457A Y479A) substitutions.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. GFP, AID, 3xFLAG, and 3xGAS tags inserted into endogenous Y47D3A.21 locus. Reference: Sharma N, et al. bioRxiv [Preprint]. 2024 Jan 19:2024.01.16.575916. doi: 10.1101/2024.01.16.575916. PMID: 38293206.

Y47H9C.2. Homozygous. Outer Left Sequence: GAGTGAGTTGGTAGCTCCGC. Outer Right Sequence: TGGTGCATCGATCGAAATTA. Inner Left Sequence: GCCACGTGTCGATAACATTG. Inner Right Sequence: CCATGAATCTTTGACGGCTT. Inner Primer PCR Length: 2844 bp. Deletion Size: 890 bp. Deletion left flank: GGTGCGGTCCACGGCTGGTCCCTATATATT. Deletion right flank: ACTATAACAAAAAGAAAACAAATACATTGT. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.14 Homozygous. Outer Left Sequence: aggtgtcaagaagagccgaa. Outer Right Sequence: cctccttgagacttgaagcg. Inner Left Sequence: cttgagcgaggtgtaggctt. Inner Right Sequence: gccaggaagaatttggtgaa. Inner Primer PCR Length: 3237. Estimated Deletion Size: about 2400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3A.16 Homozygous. Outer Left Sequence: gagatgcggaagctatgctc. Outer Right Sequence: gttgaattcctgctcctcca. Inner Left Sequence: attcaactgtgtgccagtgc. Inner Right Sequence: tggggcttcactatttggtc. Inner Primer PCR Length: 3267. Estimated Deletion Size: about 1700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47H9C.6. Homozygous. Outer Left Sequence: GGAATCGGAATTGGAACTCA. Outer Right Sequence: CTTCATCGCCACTCACTCAA. Inner Left Sequence: TAATTTCAGCCAATTTGCCC. Inner Right Sequence: CAAACGCCACTGGATTCTCT. Inner Primer PCR Length: 2153 bp. Deletion Size: 1249 bp. Deletion left flank: TCTTTTGAGAGAGCCAATAAGTTTTATTTT. Deletion right flank: TCCGCTTGCGACGACGAGGTTTGGTGTGAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47H9C.5 Homozygous. Outer Left Sequence: aaatctccaatggatgctcg. Outer Right Sequence: accatggagcaaagaaatcg. Inner Left Sequence: gccggtgtgtcataaggatt. Inner Right Sequence: atccatggttccgatgagtc. Inner Primer PCR Length: 3121. Deletion size: about 1100 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.1. Homozygous. Outer Left Sequence: AAAGTGGCACCGAGAAGTTG. Outer Right Sequence: TCAACGAACTCGAATCATCG. Inner Left Sequence: CTCGCCTCAAAACCAATGTT. Inner Right Sequence: CGTCGATACTGTGGAACGAG. Inner Primer PCR Length: 3086 bp. Deletion Size: 1960 bp. Deletion left flank: ATATTATGGGGACGCAGAAAAATTCGCATT. Deletion right flank: CTAATTTTGTTTATATTGATGAGAAAACAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 624 bp. Deletion left flank: ATTAATGTCAATCAGGCTTTCAAGTCAAGG. Deletion right flank: AATCACACTGTTACAAGAGTACAGAAAGAA. Insertion Sequence: G. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D7A.5. Homozygous. Outer Left Sequence: TTTTTCCCTCTTTATCCCGC. Outer Right Sequence: TGTAAATGTTGTTCCACCGC. Inner Left Sequence: CCAGCCCAACCTAAGCCTAA. Inner Right Sequence: AAACTTTCTGCAAAATGCTCTACA. Inner Primer PCR Length: 1187 bp. Deletion Size: 365 bp. Deletion left flank: AGAAATTATTAGTTCAAAAGTACACCAGTC. Deletion right flank: AACTCCAGTGTCAATATCCATAACATCCAC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3A.11. Homozygous. Outer Left Sequence: TTCCAGGTCAAAGAGCACCT. Outer Right Sequence: CCTTTGTAGCTGGCAAGTCC. Inner Left Sequence: CATCCAGGCTAAACTCCGTC. Inner Right Sequence: CAAAAGTACGCAGAAACCGA. Inner Primer PCR Length: 1206 bp. Deletion Size: 414 bp. Deletion left flank: GAGTTGTGGGTATCAGGTTCCGGATCATAC. Deletion right flank: TTTTCATTGGAACACTGTTTTACGGACTTG. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.11 Homozygous. Outer Left Sequence: accgctaggattttcggatt. Outer Right Sequence: gcccctgagttgcaaaatta. Inner Left Sequence: tggtattcggtatcaggagca. Inner Right Sequence: gcctctttcctgtgcacttt. Inner Primer PCR Length: 1282. Deletion size: about 400 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3A.1 Homozygous. Outer Left Sequence: ccactttcctgattcccaga. Outer Right Sequence: agccaacgttcgaaacaaac. Inner Left Sequence: gacgttgatggctccatttt. Inner Right Sequence: cccactttacatggtttggg. Inner Primer PCR Length: 1248. Deletion size: about 250 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.3 Homozygous. Outer Left Sequence: tggtcaagaacgtgctgaag. Outer Right Sequence: cagatcggcaattcggtaat. Inner Left Sequence: atcaaaccgtaacgggacag. Inner Right Sequence: tcagcagttatccaactccaaa. Inner Primer PCR Length: 1196. Deletion size: about 500 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Homozygotes Dpy and unhealthy. Deletion of 3929 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 Dpy adults (ve662 homozygotes), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: agaagaaacaaagaaatcccaaaaaaaaaa ; Right flanking sequence: Tatccgattattacagtattaaattctatc. sgRNA #1: aagaaaaaagaaacggtata; sgRNA #2: actgtaataatcggatATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3949 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttaaatccaaaaaaaactcacCGGCAAATA ; Right flanking sequence: GTCAGCTCGATCCGTGTCAGCTGTCTCGAA. sgRNA #1: aaaactcacCGGCAAATATT; sgRNA #2: ACACGGATCGAGCTGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

mGreenLantern tag inserted at the C-terminus of the endogenous idpc-1/Y47D3B.6 locus. mGreenLantern expression in the pharyngeal cuticle. Reference: Kamal M, et al. "A Spatiotemporal Reconstruction of the C. elegans Pharyngeal Cuticle Reveals a Structure Rich in Phase-Separating Proteins." https://www.biorxiv.org/content/10.1101/2022.03.11.483951v1

eGFP and 3xFLAG tags inserted into endogenous locus by CRISPR/Cas9.

ebEx126 [YAC Y47H9 [spe-9(+)] + rol-6(su1006)]. Pick Rollers to maintain. eb19 is a spe-9 non-conditional mutant.

Y47D3A.23a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.24, Y47G6A.25. Apparent homozygous lethal deletion chromosome balanced by lon-2-marked translocation. Heterozygotes are WT, and segregate WT, Lon-2 males, arrested szT1 aneuploids, and ok1536 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3A.26. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1703 homozygotes (sterile Unc). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.6. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1690 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CTGAAATCCCTTCGCACACT. External right primer: ATTGGCATTTTTCTAGCCGA. Internal left primer: GCGAAAAACAACGATTAGCC. Internal right primer: CTGGAACTTGGAAACTTGGG. Internal WT amplicon: 3142 bp. Deletion size: 1258 bp. Deletion left flank: CTACAGGAAGAGGAGAGTGGGCTCATTGAG. Deletion right flank: TTTGCCCATTTTTGCTAAAATTGAACCAAA. Insertion Sequence: CCCATTTTTGCCCATTTTTGCCCAT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13A2.8, Y47D7A.3. External left primer: ACTTCATCTGAATCGCCACC. External right primer: AATGGTTTTGACACCGCTTC. Internal left primer: TTATCAGATGCTGGTCCACG. Internal right primer: TGGTTGAAAGTTGGTGTCCA. Internal WT amplicon: 2061 bp. Deletion size: 1042 bp. Deletion left flank: AGTCGATTTATTCCTGACCCAAGTGGTATA. Deletion right flank: GCATCCCTTGTTCCATCTCCAAAATTGTAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47G6A.23. External left primer: AAGAAGCTGCTGGCCAATAA. External right primer: TGGAACTCTTCCAATTTCCG. Internal left primer: TGTTTCGGTCTAAACGAGGC. Internal right primer: TCAGTGAAGTGGCGATTGAG. Internal WT amplicon: 3251 bp. Deletion size: 1913 bp. Deletion left flank: GACTGTTGGGTTACTGTAGTGGTATTGTGG. Deletion right flank: AGTACCCTTTAAAGGTGCACGCCTTTTTTC. Insertion Sequence: GAGTAATTCTTTTTTTTTCGCGTAGCCAACAAATT. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Y47D3B.7. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok2363 homozygotes (early larval arrest). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GATGCCACTTGTTCAGGGTT. External right primer: GCATGAGAGTTACACGCGAA. Internal left primer: TGGAGACATGTACCCGTTGA. Internal right primer: ATCACACGAGCCCTCAGAAC. Internal WT amplicon: 2759 bp. Deletion size: 1315 bp. Deletion left flank: TGCTTGATAAGACCCCCCTCTACTGCAACA. Deletion right flank: CAAAATCAGAACTCAAAAGCAAAGAAGGAG. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807