| BAN580 |
C. elegans |
C03B8.3(bon104) III; mcu-1(ju1154) IV; tag-321(bon105) IV. Show Description
tag-321(bon105) is a CRISPR/Cas9-engineered 1.1 kb deletion in mcu-1(ju1154) mutant background, replicating the tag-321(bon103) lesion. The resulting double mutant was crossed with C03B8.3(bon104) males to generate the triple mutant. tag-321(bon105) genotyping primers: GGTTGTTTTCCAGTCAAATCCCTCTCAC and GCACATTGAAGTTTTGAGCAAATAACAGGG; WT: ~1330 bp; bon103: ~160 bp. Reference: Vetrella M, et al. 2025 Dec 17;17(1):923. doi: 10.1038/s41467-025-67647-y. PMID: 41408045. |
|
