Search Strains

Endogenous lgc-50 locus tagged with mNeonGreen. Inclusion of the T2A self-cleaving peptide allows mNeonGreen406 to be expressed as a cytosolic protein. Generated in N2 background. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

flvIs2 [tph-1p(short)::Chrimson + elt-2p::mCherry]. Deficits in serotonin-dependent slowing response. NSM neuron is expressing Chrimson and can be specifically activated by red light. Reference: Dag U, et al. bioRxiv 2023.01.15.524132; doi: https://doi.org/10.1101/2023.01.15.524132.

mjIs144 [mex-5p::GFP::his-58::21UR-1target::tbb-2 3'UTR + unc-119(+)] II. piRNA sensor strain. Single copy inserted into ttTi5605 (MosSCI). Superficially wild-type with loss of piRNA sensor silencing in piRNA pathway mutants (e.g. prg-1). GFP is silenced in wild-type, expressed in piRNA pathway mutants and can be used as a simple read-out for piRNA pathway function. Reference: Bagijn MP, et al. Science. 2012 Aug 3;337(6094):574-8.

Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.

21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Superficially WT. Deletion breakpoints: GTTTTCTTTCCTTGGAGAGGT//GATGCTCATATTGTAATCT.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-22 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of unc-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of bnc-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-51 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-32 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of tbx-37 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of elt-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10226 [his-72p::HIS-24::mCherry::let-858 3' UTR + unc-119(+)]. mNeonGreen knockin at N-terminus of tbx-38 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of F19F10.9 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-10 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of dmd-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-20 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of end-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ces-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of egrh-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of hlh-14 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ztf-6 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lim-7 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of spr-4 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of hmg-20 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ngn-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ref-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of vab-7 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of klf-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of lin-26 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of sox-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of nfi-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of nhr-35 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of daf-19 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of daf-3 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of elt-7 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of end-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. stIs10116 [his-72p::his-24::mCherry::let-858 3’UTR + unc-119(+)]. GFP knockin at N-terminus of pqm-1 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

GFP knockin at C-terminal of daf-12 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of egl-44 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at C-terminus of sel-8 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of daf-8 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-2 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.

ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-17 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.