Search Strains - Caenorhabditis Genetics Center (CGC)

More FieldsRestrict search to strains with endogenously-tagged loci

Strain	Species	Genotype
SX166	C. elegans	prg-1(n4357) I; prg-2(n4358) unc-22(st136) IV. Show Description Transposon silencing normal.
SX278	C. elegans	prg-1(n4357) I; prg-2(n4358) unc-22(r765) IV. Show Description Transposon silencing normal.
SX523	C. elegans	prg-1(n4357) I; prg-2(n4358) IV. Show Description 21U RNA expression abnormal. Temperature sensitive sterility. Transposon silencing abnormal. Sterile at 25.5C; maintain at 20C or below.
SX921	C. elegans	prg-2(n4358) IV. Show Description Transposon silencing abnormal. Superficially WT. Deletion breakpoints: CGGTTCGTTTTCTTGAATCG//CCTTTAAGTTTTCATCTCAA.