Search Strains

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. [NOTE: tsp-17(tm4995) is the correct allele carried in this strain. The genotype was annotated incorrectly in Masoudi N, et al. (S. Mitani, 11/2016)] Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

vtIs1 [dat-1p::GFP + rol-6(su1006)] V. Rollers. Reference: Masoudi N, et al. PLoS Genet. 2014 Dec 4;10(12):e1004767.

Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. Genome Res. 2018 May;28(5):666-675.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Mos transposon insertion into apn-1; insertion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Superficially wild-type. Deletion site verified by PCR. Reference: Meier B, et al. 2020 bioRxiv, https://doi.org/10.1101/2020.06.04.133306

Superficially wild-type. Deletion site verified by PCR. Reference: Volkova NV, et al. Nat. Commun. 2020 May 1;11(1):2169.

Life span typically abut 20 days. Ts+ allele of N2. Daf allele of BergBO. Not male fertile.

Life span typically about 25 days. Carries Ts+ locus of N2. Carries Daf locus of BergBO. Males fertile.

zIs3000 [old-1(+) + rol-6(su1006)]. Rollers. Shows life extension and stress resistance. zIs3000 is prone to silencing.

cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.

cyIs4 [cat-1p::cat-1::GFP + rol-6(su1006)]. Rollers. GFP+. bam-2 phenotype: VC4 and VC5 motorneuron axon branches extend beyond normal termination points.

Semi-dominant. Reversible paralysis. Straight and rigid body form at the restrictive temperature (30C); recovers to WT when the temperature is lowered. Previously called mah-2(cn110) and unc-110(cn110). See WBPaper00004376.

Morphological changes in the rays, especially transformation of ray 6 into a thickened shape. Appearance of abnormal protuberances around rays. Closed structure of the fan. Impaired mating ability. Exons 8-10 of the adt-1 gene, encoding most of the metalloproteinase domain of ADT-1, are deleted in adt-1(cn30).

Temperature sensitive. Dpy when grown at 15C. DpyRoller when grown at 25C. Heterozygotes are Rollers at any temperature.

kaIs12 [col-19::GFP]. Collagen COL-19 with GFP fused to C-terminus localized in the cuticle.

Superficially wild-type. Reference: Winter AD, et al. Dev Biol. 2007 Aug 15;308(2):449-61.

Defective phototaxis (light avoidance). To identify lite-1(xu7) homozygotes, place day 1 adults on a freshly seeded NGM plate with a thin lawn of OP50. Deliver 2 second pulses of short wavelength light (UV, purple, blue) from an arc lamp to the head of a worm that is slowly moving forward through a 5-10x objective lens in conjunction with a room lens under a fluorescent dissection scope. Manually move the plate so only the anterior of the worm appears in the field of view. Wild-type worms respond by initiating reversals while homozygous mutants do not. Maintain under normal conditions. Reference: Liu J, et al (2010) Nature Neurosci 13:715-22.

Light sensation defect; loss of light sensation. lite-1(xu492) is a 2701 bp deletion generated by CRISPR/Cas9-based gene editing using the Fire Lab protocol (Arribere et al., 2014). Left flanking sequence: 5’ CGTAAAAAACAACATGCCACCAC Right flanking sequence: 5' GGCGGCCACCTACGCCAGTA. Primer sequences used to detect the deletion: Forward (flanking): 5’ GAAGAAAAGGCGGTGCAAAC; Reverse (flanking): 5’ GAAGCAACAAGACGATCTCC; Forward (internal): 5’ ATGATCGCAAAAATCCTGTCGAGTC. Wild-type product: 1972 bp; xu492 product: 1475 bp; both bands should be visible if heterozygous. Reference: Zhang W, et al. PLoS Genet. 2020 Dec 10;16(12):e1009257. doi: 10.1371/journal.pgen.1009257. eCollection 2020 Dec.

Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.

Hermaphrodites have an abnormal protrusive vulva. Suppressor of certain alleles of certain genes.

A wild type C. elegans virtually indistinguishable from N2. Males mate with high efficiency, unlike Bergerac. High copy number of Tc1 elements. Active for Tc1 transposition and excision. Not temperature sensitive for growth (unlike Bergerac). See also WBPaper00001053 and WBG 10(2) 140-141 and 11(5) 60. Collected from soil in Madison, WI. Caenorhabditis elegans wild isolate (Tc1 pattern HCD).

vaIs33 [unc-2::GFP + lin-15(+)]. Superficially Wild-type.

vaIs41 [nca-2::GFP + lin-15(+)]. Superficially Wild-type.

vaIs46 [nca-1::GFP + lin-15(+)]. Superficially Wild-type.

Dominant mutant phenotypes: Unc, Mec, Tab, Deg (late embryogenesis to L4). u662 was derived from DnT1 by recombination between the dominant Unc mutation and the recessive Lethal mutation. The dominant Unc mutation is what has been retained in this strain. This Unc mutation has been called unc-?(n754) in DnT1 strains. It is likely that unc-?(n754) and deg-3(u662) are the same mutation.

Variably abnormal. Severe developmental defects. Partially lethal (approx. 2/3 fail to survive). Adult hermaphrodites have variably enlarged and shortened tails and the body cuticle is twisted. Severe egg-laying defect; some animals have a protruding vulva. Tab. Unc. Lack AVM, PVM, and PLM. ALM often fail to migrate or migrate a shorter distance.

Abnormal migration of AVM and PVM cells.

uIs60 [unc-119p::YFP + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs57 [unc-119p::YFP + unc-119p::sid-1 + mec-6p::mec-6]; appears to map to LG V. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. YFP detectable in neurons. Maintain 15-20 degrees; sick at 25 C. Reference: Calixto et al. (2010) Nature Methods 7:554-9.

uIs115 [mec-17p::RFP]. kuIs70 [alr-1p::GFP + rol-6(su1006)]. Rollers. PVM neurons are marked with RFP, allowing FACS sorting by subtraction: FACS sort red cells only to exclude exclude other neurons that are marked with either GFP or both RFP & GFP. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. dma-1(wy908) is a partial loss of function allele generated by CRISPR/Cas9-induced frame shift with multiple premature stop codons (n=6, 8 bp deletion). Fluorescent PVD- and FLP-specific morphology markers. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

wyIs891 [unc-86p::FLP + odr-1p::RFP] III. mScarlet-I::FLPon tag inserted into endogenous rab-3 locus specifically tagging isoform B, which is most abundant in neurons. GFP tag inserted into N-terminus of endogenous syd-2 locus. Reference: McDonald NA, et al. Nature. 2020 Dec;588(7838):454-458. PMID: 33208945.

wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. FLPon::GFP tag inserted into endogenous unc-44 locus, specifically tagging UNC-44L. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.

wySi919 [des-2p::myr-mScarlet::let-858 3'UTR] V. dma-1(wy1924) is a deletion allele removing LRR. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.

tmIs905 [dat-1p::alpha-synuclein(A30P) + ges-1p::DsRed] II. egIs1 [dat-1p::GFP]; reportedly maps to LG IV. hrpr-1 also known as hrp-2. yyz8 is a weak loss-of-function allele. Neurodegeneration in ADE neurons. Neurites are shorter in PDE neurons.

yyzEx41 [dat-1p::UbG76V::mRuby::T2A::mClover + rol-6(su1006)]. Pick Rollers to maintain. Red and green fluorescence in dopaminergic neurons. TWH336 can be used as a control strain.

uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1]. yyzEx41 [dat-1p::UbG76V::mRuby::T2A::mClover + rol-6(su1006)]. Pick Rollers to maintain. Red and green fluorescence in dopaminergic neurons. Red fluorescence in pharynx. Derived from parental strain TU3401, which has been reported as showing RNAi response in non-neuronal tissues.

yyzEx42 [dat-1p::mRuby::T2A::mClover + rol-6(su1006)]. Pick Rollers to maintain. Red and green fluorescence in dopaminergic neurons. Can be used as a control for Ub::mRuby in dopaminergic neurons to analyze UPS activity.

uIs69 [pCFJ90 (myo-2p::mCherry) + unc-119p::sid-1]. yyzEx42 [dat-1p::mRuby::T2A::mClover + rol-6(su1006)]. Pick Rollers to maintain. Red and green fluorescence in dopaminergic neurons. Derived from parental strain TU3401, which has been reported as showing RNAi response in non-neuronal tissues.

teIs113 [pie-1p::GFP::H2B::zif-13'UTR 771bp + unc-119(+)]. A 771 bp genomic sequence downstream of the zif-1 stop codon (starting immediately after the stop codon) was cloned downstream of pie-1 promoter-driven GFP::H2B in the germline expression vector pID3.01B. Superficially wild-type. Reference: Oldenbroek M, et al. Dev Biol. 2012 Mar 15;363(2):388-98.

teIs127 [pie-1p::GFP::H2B::mom-2 3'UTR + unc-119(+)] teIs127 construct includes a 557 bp genomic sequence beginning 100 bp upstream of the mom-2 stop codon was cloned downstream of pie-1 promoter-driven GFP::H2B. Superficially wild-type. Reference: Oldenbroek M, et al. Development. 2013 Nov;140(22):4614-23.

Heterozygotes are Unc and segregate Unc and non-Unc steriles (oma-1; oma-2 homozygotes). The Oma animal has an empty uterus and lots of oocytes in the gonad arms. Maintain by picking Uncs. zu405 is a gain-of-function mutation which results in temperature sensitive, embryonic lethality. Loss-of-function mutation in either oma-1 or oma-2 alone does not have a detectable phenotype. te33 is a dominant suppressor of the zu405 embryonic lethality. te51 is a mutation that, in the oma-1(zu405te33) background, gives an Oma (Ooctye Maturation defective) phenotype. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].