More Fields
Strain Species Genotype
PHX1592 C. elegans ceh-5(syb1592[ceh-5::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-5 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
SYS424 C. elegans ceh-5(dev103([mNeonGreen::ceh-5]) I; ujIs113 II. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-5 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
MS1206 C. elegans ceh-51(tm2123) V; irEx540. Show Description
irEx540 [ceh-51(+) + unc-119::CFP + rol-6(su1006)]. Throws arrested ceh-51(-) larvae, rescued animals expressing unc-119::CFP, and some unc-119::CFP-expressing larvae that are not rescued. Heterozygous mutant strain originally obtained from Shohei Mitani.
OP706 C. elegans unc-119(tm4063) III; wgIs706. Show Description
wgIs706 [ceh-57::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
OP808 C. elegans unc-119 (tm4063) III; wgIs808. Show Description
wgIs808 [ceh-58::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44.
PHX1551 C. elegans ceh-51(syb1551[ceh-51::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-51 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
PHX2015 C. elegans ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
SYS397 C. elegans ujIs113 II; ceh-51(dev72([mNeonGreen::ceh-51]) V. Show Description
ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::mCherry::his-24::let-858 3’UTR + unc-119(+)] II. mNeonGreen knockin at N-terminus of ceh-51 locus. Cellular protein expression pattern during embryogenesis (until bean stage) is available at http://dulab.genetics.ac.cn/TF-atlas. Reference: Ma X, Zhao Z, Xiao L, et al. Nat Methods. 2021;18(8):893-902. doi:10.1038/s41592-021-01216-1.
VC4064 C. elegans ceh-54(gk5138[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. Show Description
Homozygous viable. Deletion of 3125 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: ATTATTCTGGAAATCGGCAAAAAACCAGTT ; Right flanking sequence: GTATAGATAATGCGCTTATTCAAAGTGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.