| NK2669 |
C. elegans |
F26E4.3(qy105[F26E4.3::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous F26E4.3 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2672 |
C. elegans |
unc-40(qy68[unc-40::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous unc-40 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2673 |
C. elegans |
unc-5(qy70[unc-5::2xmNG + LoxP]) IV. Show Description
2x mNG tag inserted into the endogenous unc-5 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2688 |
C. elegans |
fbn-1(qy107[fbn-1::mNG (internal tag) + LoxP]) III. Show Description
mNG tag inserted into the endogenous fbn-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2689 |
C. elegans |
lin-35(n745) I; qyIs23 II; IqIs80 IV. Show Description
qyIs23 [cdh-3p::mCherry::PLCdPH + unc-119(+)] II. lqIs80 [SCMp::GFP::caax] IV. RNAi sensitized strain with utse and seam markers. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2692 |
C. elegans |
test-1(qy108[test-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous test-1 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2698 |
C. elegans |
sax-3(qy113[sax-3::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous sax-3 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2700 |
C. elegans |
eva-1(qy114[eva-1::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous eva-1 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2701 |
C. elegans |
nas-39(qy115[nas-39::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2702 |
C. elegans |
C48E7.6(qy116[C48E7.6::mNG + LoxP]) I. Show Description
mNG tag inserted into the endogenous C48E7.6 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2704 |
C. elegans |
cpi-2(qy117[cpi-2::mNG + LoxP]) V. Show Description
mNG tag inserted into the endogenous cpi-2 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2705 |
C. elegans |
col-99(qy118[col-99::mNG (internal tag) + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2706 |
C. elegans |
col-99(qy119[col-99::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous col-99 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2728 |
C. elegans |
cpi-1(qy127[cpi-1::mNG + LoxP]) IV. Show Description
mNG tag inserted into the endogenous nas-39 locus. Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2751 |
C. elegans |
T19D12.6(qy149[T19D12.6::mNG + LoxP]) II. Show Description
mNG tag inserted into the endogenous T19D12.6 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2764 |
C. elegans |
adm-4(qy153[adm-4::mNG + LoxP]) X. Show Description
mNG tag inserted into the endogenous adm-4 locus (internal tag). Reference: Jayadev R, et al. Sci Adv. 2022 May 20;8(20):eabn2265. doi: 10.1126/sciadv.abn2265. PMID: 35584218.
|
|
| NK2779 |
C.elegans |
fdgt-1(tm3165) II; qyIs553. Show Description
qyIs553 [lin-29p::ceGreenGlifon4000 +unc-119(+)]. fdgt-1(tm3165) null mutant strain expressing green glucose biosensor in the anchor cell. fdgt-1 formerly known as fgt-1. Reference: Garde A, et. al. Dev. Cell. 2022 Mar 28;57(6):732-749.e7. PMID: 35316617
|
|
| NK2799 |
C. elegans |
unc-119(ed4) III; qyIs570 X. Show Description
qyIs570 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)] X. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP.
|
|
| NK2920 |
C. elegans |
emb-9(qy83[emb-9::mRuby2 + LoxP]) III; gon-1(qy45[gon-1::mNG+LoxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus and mRuby2G tag inserted into the endogenous emb-9 locus (internal tag). Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2922 |
C. elegans |
lin-35(n745) I; gon-1(qy45[gon-1::mNG+loxP]) IV. Show Description
CRISPR/Cas9 insertion of mNeonGreen into the endogenous gon-1 locus in an RNAi-sensitized background. Reference: Gianakas CA, et al. J Cell Biol. 2023 Jan 2;222(1):e202112096. doi: 10.1083/jcb.202112096. PMID: 36282214.
|
|
| NK2964 |
C. elegans |
nifk-1(qy126[nifk-1::mNG]) zmp-1(cg115) III. Show Description
mNG tag inserted into the C-terminus of the endogenous nifk-1 locus.
|
|
| NK2984 |
C. elegans |
let-2(qy216[let-2::mRuby2]) X. Show Description
mRuby2 tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3026 |
C. elegans |
let-2(qy228[let-2::mNG]) X. Show Description
mNG tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3057 |
C. elegans |
emb-9(qy236[emb-9::mNG]) III. Show Description
mNG tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3072 |
C. elegans |
emb-9(qy244[emb-9::mRuby2]) III. Show Description
mRuby2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3073 |
C. elegans |
emb-9(qy245[emb-9::mEos2]) III. Show Description
Photoconvertible mEos2 tag inserted into the endogenous emb-9 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3114 |
C. elegans |
crls-1(qy255[crls-1::mNG]) III. Show Description
mNeonGreen tag inserted into C-terminus of endogenous crls-1 locus. Insertion verified by PCR. Left flanking sequence: 5' AGTCACTACCACCGGAAGAACG 3' ; Right flanking sequence: 5' CTTGGTTTCGGCACTGGTGTTTC 3'. sgRNA: 5' CGGGACTACAGTATGCCAGTAA 3'.
|
|
| NK3229 |
C. elegans |
unc-119(ed4) III; qyIs629. Show Description
qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR.
|
|
| NK3236 |
C. elegans |
qySi252 [let-2p::mNG] I. Show Description
qySi252 [let-2p::mNG] I. Single-copy CRISPR-based integration into ttTi4348. Wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3237 |
C. elegans |
let-2(qy286[let-2::P2A::PEST::mNG]) X. Show Description
Endogenous reporter of type IV collagen alpha chain (let-2) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of let-2 and mNG. P2A causes let-2 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3238 |
C. elegans |
emb-9(qy287[emb-9::P2A::PEST::mNG]) III. Show Description
Endogenous reporter of type IV collagen alpha chain (emb-9) translation. mNG tag inserted at the endogenous C-terminus locus with a P2A sequence between the C-terminus of emb-9 and mNG. P2A causes emb-9 to be translated independently of mNG. Cytosolic mNG is a reporter of translation. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3240 |
C. elegans |
emb-9(qy288[emb-9 (G1173D)::mNG]) III. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b117) of emb-9. Tagged with mNG at the C-terminus. Temperature sensitive. Semi-dominant. Egg lethal. Not maternal. Will grow at 20C. See also CGC DH117. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3241 |
C. elegans |
let-2(qy289[let-2 (G1287D)::mNG]) X. Show Description
Endogenously tagged temperature sensitive glycine substitution mutant allele (b246) of let-2. Tagged with mNG at the C-terminus. Temperature sensitive embryonic lethal. Grows at 15C, 20C. Lethal at 25C (embryonic). See also CGC DH246. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3242 |
C. elegans |
let-2(qy290[let-2::mMaple]) X. Show Description
Photoconvertible mMaple tag inserted into the endogenous let-2 locus (C-terminus tag). Healthy strain, wild-type growth. Reference: Srinivasan S,et al. J Cell Biol. 2025 224(6):e202412118. doi:10.1083/jcb.202412118 PMID: 40100062.
|
|
| NK3281 |
C. elegans |
unc-119(ed4) III; unc-6(ev400) X; qyIs552. Show Description
qyIs552 [lin-29p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of ratiometric ATP:ADP biosensor PercevalHR. netrin null mutant background (ev400).
|
|
| NK3304 |
C. elegans |
qySi313 I; unc-119(ed4) III; qyIs629. Show Description
qySi313 [lin-29p::ucp-4::SL2::mKate2::PLC(delta)PH::3xHA::tbb-2 3'UTR] I. qyIs629 [eef-1A.1p::PercevalHR::unc-54 3'UTR + unc-119(+)]. Ubiquitous somatic expression of ratiometric ATP:ADP biosensor PercevalHR. Anchor cell specific overexpression of mitochondrial uncoupling protein, UCP-4, (expression confirmed by presence of red anchor cell membrane). qySi313 inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK3306 |
C. elegans |
unc-119(ed4) III; unc-6(ev400) X; qyIs636. Show Description
qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP in netrin null mutant background (ev400).
|
|
| NK3314 |
C. elegans |
qySi148 I; unc-119(ed4) III; qyIs636. Show Description
qySi148 [lin-29p::2xmKate2::PLCdeltaPH] I. qyIs636 [lin-29p::EMTB::GFP::unc-54 3'UTR + unc-119(+)]. Anchor cell specific expression of encosin microtubule binding domain (EMTB) fused to GFP. Plasma membrane marker inserted into ttTi4348 mosSCI site (I:-5.32) using CRISPR/Cas9-mediated recombination.
|
|
| NK358 |
C. elegans |
unc-119(ed4) III; qyIs43. Show Description
qyIs43 [pat-3::GFP + ina-1(genomic) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Hagedorn et al., Dev Cell (2009) Aug 17(2):187-98.
|
|
| NK413 |
C. elegans |
rrf-3(pk1426) II; qyIs50 V. Show Description
qyIs50 [cdh-3p::moeABD::mCherry + unc-119(+)] V.
|
|
| NK564 |
C. elegans |
unc-119(ed4) III; qyEx78. Show Description
qyEx78 [Venus::unc-6(deltaSP) + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK640 |
C. elegans |
rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs102. Show Description
qyIs102 [fos-1ap::rde-1(genomic) + myo-2::YFP + unc-119(+)]. Uterine-specific RNAi.
|
|
| NK741 |
C. elegans |
rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs138. Show Description
qyIs138 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
|
|
| NK742 |
C. elegans |
rrf-3(pk1426) II; unc-119(ed4) III; rde-1(ne219) V; qyIs139. Show Description
qyIs139 [unc-62p::rde-1(genomic) + myo-2::YFP + unc-119(+)]. VPCs sensitive to RNAi. Vul phenotype from lin-39 RNAi depletion.
|
|
| NK772 |
C. elegans |
unc-119(ed4) III; qyEx115. Show Description
qyEx115 [C11D9.1::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK773 |
C. elegans |
unc-119(ed4) III; qyEx114. Show Description
qyEx114 [C28C12.10::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK776 |
C. elegans |
unc-119(ed4) III; qyEx118. Show Description
qyEx118 [exc-5::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK777 |
C. elegans |
unc-119(ed4) III; qyEx121. Show Description
qyEx121 [F55C7.7d::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK778 |
C. elegans |
unc-119(ed4) III; qyEx120. Show Description
qyEx120 [F55C7.7c::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|
| NK779 |
C. elegans |
unc-119(ed4) III; qyEx119. Show Description
qyEx119 [F13E6.6::GFP + unc-119(+)]. Maintain by picking non-Unc.
|
|