| CBX102 |
Microbacterium nematophilum |
Microbacterium nematophilum Show Description
Bacteria. Caenorhabditis pathogen. Previously called Aureobacterium nematophilum. Biosafety Level: BSL-1. The CGC maintains this bacteria on NGM.
|
|
| CE1338 |
C. elegans |
epIs14. Show Description
epIs14 [sbp-1p::GFP + rol-6(su1006)]. Rollers. sbp-1 previously known as pin-1. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| CE1494 |
C. elegans |
+/hT2 [dpy-18(h662)] I; pen-2(ep220)/hT2 [bli-4(e937)] III. Show Description
Heterozgyotes are WT and segregate WT, Dpys, and Ste or Mel. Pick wild-type individuals and check for correct segregation of progeny to maintain. bli-4 is suppressed by dpy-1 in hT2 homozygotes-only see a very few DpyBli.This strain cannot be distributed to commercial organizations. ep220 is likely Mel. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| CE1857 |
C. elegans |
ect-2(e1778)/unc-4(e120) sqt-1(sc13) II. Show Description
Heterozygotes are WT and segregate WT, Roller Uncs, and ect-2 homozygotes (sterile Uncs which reach adulthood, sometimes giving polynucleate oocytes). ect-2 pka let-21. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| CE541 |
C. elegans |
sbp-1(ep79) III. Show Description
Slow growth, low fat stores. Viable at 15C, not at 25C. Slightly Dpy, reduced brood size, low penetrance. Maintain under normal conditions. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. Reference: Liang et al., (2010) PlosOne 5:3 e9869.
|
|
| CER178 |
C. elegans |
nfki-1(cer1) X. Show Description
cer1 is a CRISPR-generated 368 bp deletion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
|
|
| CER187 |
C. elegans |
nfki-1(cer2) X. Show Description
cer2 is a CRISPR-generated 438 bp deletion + 50 bp insertion removing intron 2 and part of exon 3, creating a premature stop codon. Low penetrance of developmental defects such as abnormal L1 morphology, aberrant gonad migration, and an abnormal number of distal tip cells. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
|
|
| CER323 |
C. elegans |
ubh-4(cer27) II. Show Description
Reduced brood size. Genetic interaction with rpn-9. cer27 is a 1033 bp deletion removing the start codon and nearly all of the ubh-4 coding sequence. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
| CER444 |
C. elegans |
sftb-1(cer114[mCherry::sftb-1]) III. Show Description
Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
|
|
| CER461 |
C. elegans |
nfki-1(cer116[eGFP::nfki-1]) X. Show Description
eGFP tag inserted into the endogenous nfki-1 locus. eGFP::NFKI-1 signal is observed in diverse neurons in the animals' head and tail throughout post-embryonic development. No obvious phenotype. Reference: Brena D, et al. Sci Rep. 2020 Sep 30;10(1):16153.
|
|
| CER522 |
C. elegans |
ubh-4(cer140) rpn-9(gk401)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
Homozygous viable mutation balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP cer140 gk401 homozygotes (synthetic sterile). Pick WT dim GFP and check for correct segregation of progeny to maintain. Generated by CRISPR-mediated deletion of ubh-4 in gk401 mutant background. Reference: Martinez-Fernandez C, et al. Cells. 2023 Mar 18;12(6):929. doi: 10.3390/cells12060929. PMID: 36980270
|
|
| CER529 |
C. elegans |
sftb-1(cer144) III. Show Description
Dose-dependent sensitivity (developmental arrest) to pladienolide B and herboxidiene (modulators of pre-mRNA splicing). sftb-1(cer144[S1090A, A1095T, I1096V, F1101Y]) contains four missense mutations reproducing the HEAT repeat 15 of the human SF3B1 protein. Ten silent mutations increase primer specificity for PCR genotyping. Primers used for genotyping: (WT For: GAGCTGCAATTAATACATTTGGATTT) (WT Rev: AAACTCGCATTCCTTCACAT) (cer144 For: GGTACTATTCTGTGGCGTCT) (cer144 Rev: GTAACCGAAAGTGTTCACAGTT) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
|
|
| CER554 |
C. elegans |
comt-4(cer157[comt-4p::GFP::H2B]) V. Show Description
No obvious phenotype. comt-4(cer157) is a complete deletion of the comt-4 gene (coding sequence + introns), which was replaced by GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019), thereby creating a null allele and a transcriptional reporter at the same time. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
|
|
| CER588 |
C. elegans |
cat-2(cer181[cat-2p::GFP::H2B 1-3]) II. Show Description
Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martínez-Fernández C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130
|
|
| CER660 |
C. elegans |
cer227[mex-5p::SpG(smu-2 introns) + unc-119(+)] II; unc-119(ed3) III. Show Description
Missense mutations D1135L and S1136W, G1218K and E1219Q, and R1335Q and T1337R were introduced on the Cas9 gene at EG9615 strain, to cause endogenous expression of the Cas9 variant SpG. SpG is efficient for CRISPR on NGN PAM sites. Reference: Vicencio J, et al. Nature Communication, 2022. May 12;13(1):2601. doi: 10.1038/s41467-022-30228-4.
|
|
| CER7 |
C. elegans |
rsr-2(tm2607) II. Show Description
Superficially wild-type. tm2607 is a 196 bp deletion + 1bp insertion that removes part of an essential gene, but produces viable animals. Reference: Fontrodona L, et al. PLoS Genet. 2013 Jun;9(6):e1003543.
|
|
| CF1097 |
C. elegans |
ref-1(mu220) II. Show Description
P9.p and P10.p fail to fuse with hyp7 during L1 in hermaphrodites. Misshapen head (low penetrance) most visible in L1. Ectopic postdeirid generated by V6 (low penetrance).
|
|
| CF1380 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which completely rescues dauer formation and partially restores longevity of daf-16; daf-2 double mutants. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
| CF1724 |
C. elegans |
daf-16(mu86) I; daf-2(e1370) III; muIs105. Show Description
muIs105 [daf-16p::GFP::daf-16 + rol-6(su1006)]. Rollers; Rol phenotype is not always evident). Integrated line derived from CF1449. Maintain at 15C. Forms dauers at 25C. Reference: Lin K, et al. Nat Genet. 2001 Jun;28(2):139-45.
|
|
| CF1880 |
C. elegans |
daf-16(mu86) I; glp-1(e2141) III. Show Description
Sterile at 25C; grow at 20C or less. glp-1(e2141) longevity suppressed by daf-16(mu86).
|
|
| CF1903 |
C. elegans |
glp-1(e2144) III. Show Description
Temperature sensitive. Sterile at 25C. Maintain at 15C. [NOTE: CF1903 carries glp-1(e2144), not e2141 as previously described.]
|
|
| CF2060 |
C. elegans |
daf-16(mu86) I; muEx158. Show Description
muEx158 [daf-16cAM::GFP + sur-5p::GFP] (AM = AKT-site mutant). Pick GFP+ worms to maintain. Sterile at 25C; grow at 20C or less. muEx158 contains GFP-tagged daf-16 c isoform (described as a1 isoform in Lin, et al. Nat Genet. 2001) with 4 Ser/Thr residues mutated to Ala, which rescues daf-16 mutants from defective dauer formation and also partially rescues longevity defect of daf-16; glp-1 double mutants. Reference: Berman JR, & Kenyon C. Cell. 2006 Mar 10;124(5):1055-68.
|
|
| CF2065 |
C. elegans |
kri-1(ok1251) I; glp-1(e2141) III. Show Description
Temperature-sensitive. Sterile at 25C. [NOTE: can be grown at 20C, but 15C might be better for long-term propagation.] kri-1(ok1251) suppresses the longevity of glp-1(e2141) mutants.
|
|
| CF267 |
C. elegans |
muIs6 IV. Show Description
muIs6 [lin-39::lacZ + rol-6(su1006)] IV. lin-39 promoter driving lacZ. muIs6 was integrated by gamma irradiation.
|
|
| CF2805 |
C. elegans |
dop-2(vs105) V; dop-4(ok1321) dop-1(vs100) dop-3(vs106) X Show Description
Quadruple mutant removing four different dopamine receptor genes.
|
|
| CF2885 |
C. elegans |
aqp-1(tm2309) II. Show Description
Homozygous viable, but short-lived. Reference: Lee SJ, et al. Cell Metab. 2009 Nov;10(5):379-91.
|
|
| CF3166 |
C. elegans |
muEx473. Show Description
muEx473 [kin-19p::kin-19::tagRFP + tph-1p::GFP]. Pick RFP+ GFP+ animals to maintain. Low transmission rate. Translational fusion of KIN-19 displaying age-dependent aggregation. Reference: David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
|
|
| CF3649 |
C. elegans |
muIs209. Show Description
muIs209 [myo-3p::kin-19::tagRFP + tph-1p::GFP]. KIN-19::tagRFP aggregates with age in body-wall muscles. Animals have reduced thrashing compared to controls. Generated in N2 background. References: Huang YC, et al. Elife. 2019 May 3;8. pii: e43059. doi: 10.7554/eLife.43059. David DC, et al. PLoS Biol. 2010 Aug 10;8(8):e1000450.
|
|
| CF439 |
C. elegans |
lin-39(mu26) III; dpy-20(e1282) IV; him-5(e1490) V; muIs23. Show Description
muIs23 [hsp::lin-39 + (pMH86) dpy-20(+)]. Heat-shock inducible lin-39. muIs23 is a spontaneous integrant whose chromosomal location is unknown. [NOTE: This strain was previously described as carrying lin-39(n1760), but it is actually carrying the g to a substitution of mu26. Strain MT7255 has been confirmed to be carrying the a to t substitution of n1760.]
|
|
| CF4586 |
C. elegans |
muIs252 II; unc-119(ed3) III; vha-13(mu493[wrmScarlet11::vha-13]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::vha-13 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4592 |
C. elegans |
muIs253 II; unc-119(ed3) III; his-3(mu496[his-3::sfGFP11]) V. Show Description
muIs253 [eft-3p::sfGFP1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Somatic expression of sfGFP1-10 (under the control of the eft-3 promoter and the unc-54 3'UTR). GFP11 tag inserted into endogenous his-3 locus via CRISPR/Cas9 insertion into parental strain CF4587. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4594 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu497[his-3::wrmScarlet11]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4601 |
C. elegans |
muIs252 II; unc-119(ed3) III; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4608 |
C. elegans |
muIs252 II; unc-119(ed3) III; his-3(mu500[his-3::wrmScarlet11(x3)]) V. Show Description
muIs252 [eft-3p::wrmScarlet1-10::unc-54 3'UTR + Cbr-unc-119(+)] II. Homozygous viable. Endogenously-tagged his-3::wrmScarlet11(x3) generated via CRISPR/Cas9 insertion of three wrmScarlet11 tags into the endogenous his-3 locus in parental strain CF4582. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4611 |
C. elegans |
muIs257 I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
muIs257 [myo-3p::wrmScarlet1-10::unc-54 3'UTR] I. Homozygous viable. Endogenously-tagged wrmScarlet11::linker::fib-1 generated via CRISPR/Cas9 insertion into parental strain CF4610. Reference: Goudeau J, et al. Genetics. 2021 Apr 15;217(4):iyab014. doi: 10.1093/genetics/iyab014. PMID: 33693628
|
|
| CF4639 |
C. elegans |
glh-1(sam140[glh-1::T2A::wrmScarlet(1-10)]) I; fib-1(mu498[wrmScarlet11::fib-1]) V. Show Description
fib-1(mu498[wrmScarlet11::fib-1]) generated via CRISPR/Cas9 insertion into parental strain DUP237; transgene contains a linker between wrmScarlet11 and fib-1. Endogenous fib-1 detectable in the germline. T2A::wrmScarlet(1-10) fused to the C-terminus of endogenous GLH-1. The T2A self-cleaving peptide separates wrmScarlet(1-10) from GLH-1 post-translationally so that wrmScarlet(1-10) disperses throughout germ cell nuclei and cytoplasm. wrmScarlet(1-10) is also maternally loaded into embryos, where it persists through early and mid-embryonic development. Reference: Goudeau J, et al. bioRxiv 2020.07.02.185249; doi: https://doi.org/10.1101/2020.07.02.185249. Goudeau J, et al. Genetics. 2021 Apr; 217(4): iyab014. PMID: 33693628.
|
|
| CG1428 |
C. elegans |
tmc-1(rg1003) X. Show Description
rg1003 promotes development and male mating behavior on a chemically defined C. elegans maintenance medium (CeMM). Reference: Zhang L, et al. Nature Communications (2015) In press.
|
|
| CGC102 |
C. elegans |
mir-61(umn14[lox2272 + myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-61 pre-miRNA deletion strain deletion allele in which mir-61 pre-miRNA was replaced by myo-2p::wrmScarlet. Generated in parental strain N2. Rollers. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC103 |
C. elegans |
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + lox2272]) V. Show Description
mir-61(umn15[lox2272 myo-2p::wrmScarlet + lox511I + Lox2272]) V. Derived by CRE-meditated excision of SEC in parental strain CGC102, leaving myo-2p::wrmScarlet.
|
|
| CGC104 |
C. elegans |
mir-61(umn16[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC102, leaving disrupted mir-61 locus.
|
|
| CGC110 |
C. elegans |
mir-250(umn21[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-250 pre-miRNA deletion strain deletion allele in which mir-250 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC111 |
C. elegans |
mir-250(umn22[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC110, leaving myo-2p::wrmScarlet.
|
|
| CGC112 |
C. elegans |
mir-250(umn23[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC110, leaving disrupted mir-250 locus.
|
|
| CGC113 |
C. elegans |
mir-61&mir-250(umn24[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272)] V. Show Description
mir-61&mir-250 pre-miRNA deletion strain deletion allele in which mir-61&mir-250 pre-miRNAs were replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC114 |
C. elegans |
mir-61&mir-250(umn25[lox2272 myo-2p::wrmScarlet + lox511I + lox2272)] V. Show Description
Derived by CRE-meditated excision of SEC in parental strain CGC113, leaving myo-2p::wrmScarlet.
|
|
| CGC115 |
C. elegans |
mir-61&mir-250(umn26[lox2272]) V. Show Description
Derived by CRE-meditated excision of SEC and myo-2p::wrmScarlet in parental strain CGC113, leaving disrupted mir-61&mir-250 loci.
|
|
| CGC120 |
C. elegans |
mir-792(umn31[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-792 pre-miRNA deletion strain deletion allele in which mir-792 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC121 |
C. elegans |
mir-785(umn32[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-785 pre-miRNA deletion strain deletion allele in which mir-785 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC122 |
C. elegans |
mir-392(umn33[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-392 pre-miRNA deletion strain deletion allele in which mir-392 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC123 |
C. elegans |
mir-57(umn34[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) II. Show Description
mir-57 pre-miRNA deletion strain deletion allele in which mir-57 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|