Search Strains

cp65[mrck-1::YPet + LoxP]. YPet inserted at the C terminus of endogenous mrck-1 gene by Cas9-triggered homologous recombination. Floxed unc-119 selection cassette was subsequently removed by Cre/Lox recombination leaving a LoxP scar after the 3'UTR. Yellow fluorescence in early embryos, larvae, and adults. Reference: Marston DJ, et al. Curr Biol. 2016 26:2079-2089.

cpIs89 [wrt-2p::2x mTurquoise2::PH::tbb-2 3'UTR loxN] I. cpIs85 [egl-20p::2x mKate2::PH::3xHA::tbb-2 3'UTR loxN] II. mNeonGreen::3xFlag tag inserted at the C-terminus of the endogenous egl-20 locus. 2x mTurquoise2::PH membrane marker expressed in seam cells, Q neuroblasts, and many hypodermal cells. Expression of 2x mKate2::PH membrane marker driven by egl-20 upstream intergenic sequence. cpIs89 is a single copy transgene inserted at Chr I:2851088 near ttTi4348 using Cas9-triggered homologous recombination. cpIs85 is a single copy transgene inserted at Chr II:8420157-8420243 near ttTi5605 using Cas9-triggered homologous recombination. Reference: Gibney TV & Pani AM. Development. 2025 Aug 21:dev.204802. doi: 10.1242/dev.204802. PMID: 40838367.

mNG reporter inserted into endogenous unc-94 locus, specifically tagging the UNC-94A isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102.

mNG reporter inserted into endogenous unc-94b locus, specifically tagging the UNC-94B isoform. Reference: Zhang P, et al. 2023 Sep 4;222(9):e202302102. doi: 10.1083/jcb.202302102. PMID: 37351566.

Viable allele of stn-1. dys-1-like. Hyperactive, tend to hypercontract, bends head when moving forward. F30A10.8.

xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchEx97 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. GFP-only control strain for LSD2104. Upon heat shock, GFP is expressed and secreted into the extracellular space. Generated in PD8120 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

xchIs15 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42::let-858 3’UTR + rol-6(su1006)]. Maintain at 15C: Prone to transgene suppression at higher temperatures. Rollers. Upon heat shock, human amyloid beta is expressed and secreted into the extracellular space. Aggregates are found in the extracellular space after 16 hours. Generated in N2 background. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486.

wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.

wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. wleEx35 [unc-54p::DanRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP]. Pick animals expressing GFP in their pharynx to maintain wleEx35. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon expression of temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.

wleSi1580 [unc-54p::JFF_luciferase + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.

wleSi1582 [unc-54p::JFF_luciferaseTAG185 + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.

vsIs164 [unc-103p(E)::GCaMP5 + unc-103p(E)::mCherry + lin-15(+)] X. Integrated transgene using unc-103e promoter to drive GCaMP5 and mCherry expression in vulval muscles; useful for visualizing and quantitating calcium influx in vulval muscle cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsIs172 [lin-11(enhancer)::pes-10p::GCaMP5 + lin-11(enhancer)::pes-10p::mCherry + lin-15(+)]. Integrated transgene using lin-11 enhancer region fused to the pes-10 basal promoter to drive GCaMP5 and mCherry expression in VC motor neurons; useful for visualizing and quantitating calcium influx in VC motor neurons. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsIs177 [ocr-2p::GCaMP5::ocr-2 3'UTR + ocr-2p::mCherry::ocr-2 3'UTR + lin-15(+)] X. Integrated transgene using ocr-2 promoter to drive GCaMP5 and mCherry expression in uv1; useful for visualizing and quantitating calcium influx in uv1 cells. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsIs183 [nlp-3p::GCaMP5::nlp-3 3'UTR + nlp-3p::mCherry::nlp-3 3'UTR + lin-15(+)] X. Integrated transgene using nlp-3 promoter to drive GCaMP5 and mCherry expression in HSN; useful for visualizing and quantitating calcium influx in HSN. Reference: Collins K, et al. Elife. 2016 Nov 16;5. pii: e21126. doi: 10.7554/eLife.21126.

vsSi39 [goa-1-gfp(Q205L) + unc-119(+)] II. Single-copy mosSCI insertion of the gain-of-function goa-1(Q205L)::GFP translational fusion driven by 5kb of the goa-1 promoter. Animals have shallow body bends and are egg-laying defective. Reference: Kumar S, et al. G3 (Bethesda). 2021 Aug 7;11(8):jkab167. doi: 10.1093/g3journal/jkab167. PMID: 34003969

Phenotypically WT. Deletion allele. A "T" is added also. The end points of the deletion are: TCGAACGTCAACAACATATTGCAAAT.....t.....TTGGAAAGGTAGGCTTACACTT TTTTTAA.

vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab].

vsIs13 [lin-11::pes-10::GFP + lin-15(+)]. GFP expression in six VC neurons and posterior intestine. vsIs97 [tph-1p::DsRed2 + lin-15(+)]. DsRed2 expression in HSN, NSM, and associated processes. Additional background expression in tail and a pair of head neurons. NOTE: tph-1p::DsRed2 expression pattern is different than GFP expression driven by the same promoter [Koelle Lab]. vsIs100 [myo-3p::CFP + lin-15(+)]. CFP expression in VMs. Additional background expression seen as punctate nucleolar fluorescence along the ventral side of the worm (also present in wild-type).

vsEx494 [ocr-2p::GFP::ocr-2 3'utr + lin-15(+)]. Labels the cells that express ocr-2. Pick non-Muv and GFP+ to maintain.

Temperature sensitive Egl and Unc. 318 pb deletion including exons 6 and 7. Possibly an allele of exp-3.

A 150 bp deletion in F44A2.2 corresponding to base pairs #27451-27600 in the published C. elegans cosmid F44A2 sequence (Genbank accession #U41993). The predicted protein F44A2.2 is called "nshab1", which is homologous to potassium voltage-gated channel subfamily B, member 2.

Superficially WT.

wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

stEx30 [myo-3p::GFP::myo-3 + rol-6(su1006)]. Rollers. Pick GFP+ Rollers to maintain. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqIs11 [lgg-1p::mCherry::GFP::lgg-1 + rol-6]. Rollers. Tandem-tagged autophagy reporter strain.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

sqIs19 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. [NOTE: the array does not segregate 100% in original stock; pick GFP+ and check for correct segregation to maintain the array. New stock recevied at CGC June, 2016.] Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

sqIs17 [hlh-30p::hlh-30::GFP + rol-6(su1006)]. Rollers. Slightly longer lived at 20C. hlh-30::GFP expression should be visible at relatively low magnification. Derived from JIN1679. Reference: Lapierre LR, et. al. Nat Commun. 2013 Aug 8;4:2267.

adIs2122 [lgg-1::GFP + rol-6(su1006)]. Rollers. Reference: Egan DF, et al. Science. 2011 Jan 28;331(6016):456-61.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Sterile at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqEx67 [rgef-1p::mCherry::GFP::lgg-1 + rol-6]. Rollers. Pick Rollers to maintain.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. mgEx779 [lipl-4p::lipl-4::SL2::GFP + myo-2p::mCherry]. Pick RFP+ Rollers to maintain. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

adIs2122 [lgg-1p::GFP::lgg-1 + rol-6(su1006)]. Rollers. Maintain at 15C or 20C. Approx. 50% sterility at 25C. Reference: Lapierre LR, Curr Biol. 2011 Sep 27;21(18):1507-14.

sqEx146 [sqst-1p::sqst-1 + rol-6]. Pick Rollers to maintain array. Strain over-expresses non-tagged p62/SQST-1, a key autophagy substrate. Reference: Kumsta C, et al. Nat Commun. 2019 Dec 11;10(1):5648.

muIs84 [sod-3p::GFP + rol-6(su1006)]. Weak rollers. Reference: Kumsta C, Hansen M. PLoS One. 2012;7(5):e35428.

Recessive. Mild uncoordination and aldicarb resistance. Marked resistance to volatile anesthetics, isoflurane and halothane, is semi-dominant. Isolated in RM25 (essentially the same as TR403 - high copy Tc1). [NOTE (07/09/2020): a user has reported their stock received in Dec 2019 is not resistant to isofluorane]

Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.

Suppresses hypoxia resistance of ddx-52(gc51). gc54 and gc55 are both missense alleles of ulp-4, but may behave somewhat differently. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.

Gain-of-function mutation. Suppresses hypoxia resistance of ddx-52(gc51). gc63 gc64 occurred in the same mutagenesis; unclear which allele (or if both) is causing the gain of function. Reference: Itani OA, et al. Current Biology. 2021/01/11/ 2021;31(1):128-137.e5. PMID: 33157031.

Superficially wild-type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Superficially wild type. Seed mutation of mir-35 was made by two rounds of CRISPR/Cas9 editing. cdb2 is a 50 bp deletion of the mir-35 locus. cdb4 was created by successive homology-directed repair of the disrupted mir-35 locus with a protospacer to preserve the secondary structure of the primary and precursor hairpin. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Superficially wild-type. egl-1(cdb97) contains engineered mutations in mir-35 binding site in the 3’UTR region making the sequence complementary to the mir-35(cdb4) variant. Reference: Yang B, et al. Genes Dev. 2020 Sep 1;34(17-18):1227-1238. PMID: 32820039

Superficially wild-type. Reference: Vieux K-F, et al. Nucleic Acids Res. 2021. doi:10.1093/nar/gkab840 PMID: 34586415

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1367 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1367 array contains a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1368 [U6p::rrn-1(sgRNAs1-4 targeting the rrn-1 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1368 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.

bcSi69 [hsp-16.41p::dCas9::SV40-NLS::HA::GS-linker::SV40-NLS::GFP::GFP::SV40-NLS::mai-2 3’UTR + Cbr-unc-119(+)] IV. bcEx1370 [U6p::rrn-4(sgRNAs1-4 targeting the rrn-1 locus) + U6p::rrn-4(sgRNAs1-4 targeting the rrn-4 locus) + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. After heat shock, distinct spots of GFP fluorescence are visible in the nucleus. bcEx1370 array contains a PCR product of 4 different guide RNAs targeting rrn-1 (around 100 repeats of rrn-1 on LG I) and a PCR product of 4 different guide RNAs targeting rrn-4 (around 100 repeats of rrn-4 on LG V). Reference: Memar N, et al. In vivo labeling of endogenous genomic loci in C. elegans using CRISPR/dCas9. MicroPubl Biol. 2022 Dec 13;2022:10.17912/micropub.biology.000701. doi: 10.17912/micropub.biology.000701. PMID: 36606081; PMCID: PMC9807462.