Search Strains

Unc. Semidominant Egl-c, Sma.

Unc. Semidominant Eat (TB relaxation defective).

Unc. Semidominant Egl, Lon, Slow and Floppy

Blistered cuticle. Egl-Lon, slow and floppy. Unc.

n582 is Egl, Lon, slow & floppy. Suppressed by ad952, which is semidominant. Strain is slightly Dpy and the pharyngeal bulb occasionally shows delayed relaxation and repolarization.

Lon. Sluggish Unc. Egl. Eat. Rubberband.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1004 [F25B3.3p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1004 does not rescue egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1015 [dpy-7p::egl-15(5A) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1015 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1054 [dpy-7p::egl-15(5A)(ecto) + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. olaEx1054 rescues egl-15(n484) suppression of cima-1 AIY presynaptic defects. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

wyIs45 [ttx-3p::GFP::rab-3 + unc-122p::RFP] X. olaEx1411 [dpy-7p::egl-15(5A)::HA + unc-122p::GFP]. Maintain by picking animals with GFP expression in coelomocytes. Reference: Shao Z, et al. Cell. 2013 Jul 18;154(2):337-50.

icbSi228 [ttTi5605_right::wrt-2p::wCherry::Dam:linker:egl-13NLS::vhhGFP4::unc-54::unc-119 3'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.

icbSi228 [ttTi5605_right::wrt-2p::wcherry::Dam:linker:egl-13NLS:vhhGFP4::unc-54::unc1193'UTR::unc-119::unc-119p::ttTi5605_left)] II. Wild-type growth and movement.

Dauer defective. Egl-60% form bags of worms. Unc-sluggish, poor backing. Resistant to both imipramine and serotonin. Slightly Dpy.

Egl. Rol.

Made by crossing MT3353 egl-15(n484) sma-5(n678) with N2 males and selecting animals that grew much better. FK312 probably only carries the sma-5(n678) mutation but that has not been confirmed by sequencing. Small body size, slow growth, abnormal intestinal granules, shorter lifespan than WT.

Heterozygotes are WT and segregate WT, Egl Lon, and tm246 homozygotes (temperature sensitive lethal which can be maintained as homozygotes at 15C). tm246 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::Venus. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Break points: egl-17 X. Covered region (Mb) (0.5) Balancer marked with myo-2p::mCherry. Egl. Reference: Dejima K, et al. Cell Rep. 2018 Jan 2;22(1):232-241.

Internal tag of EGL-19 at N-terminal side of exon 3 via CRISPR/Cas9 knock-in of mScarlet at egl-19 locus. Tags isoforms a and b. Insertion verified by PCR and fluorescence. Left flank: 5' ttatttgaatgagcaaaaaataaatttcag 3'; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3’ (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60; SEC insertion allele strain (balanced): GLW52.

arIs92[egl-17p::NLS-CFP-LacZ + unc-4(+) + ttx-3::GFP]. Do not distribute this strain; other labs should request it from the CGC.

arIs82 [lin-12::GFP + egl-17p::lacZ + unc-4(+)]. Reference: Shaye DD, Greenwald I. Nature. 2002 Dec 12;420(6916):686-90. Do not distribute this strain; other labs should request it from the CGC.

aSi8 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7s::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

aSi10 [lox2272 Cbr-unc-119(+) lox2272 + loxP::unc-54 3’UTR::Split 3’ HygR::tjp2a_guide::Split 3’ mScarlet-I::egl-13nls::tbb-2 3’UTR]?II. Strain contains a specialized safe harbor transgene landing pad for integration of promoters to drive mScarlet. Reference: Stevenson ZC, et al. bioRxiv 2022.10.30.514301; doi: https://doi.org/10.1101/2022.10.30.514301. Paper accepted at eLife.

aSi23 [lox2272::Cbr-unc-119(+)::lox2272::mec-7p:: NLS::GCaMP7f::egl-13-NLS::SL2::NLS::mScarlet-I:: egl-13-NLS] II. mec-7 promoter driving nuclear-localized expression of GCaMP7f in ALM, PLM, AVM & PVM neurons. Reference: Ding J, et al. GE (Bethesda). 2023 Sep 30;13(10):jkad183. doi: 10.1093/g3journal/jkad183. PMID: 37565483.

mfIs4 [egl-17::YFP + daf-6::CFP + unc-119(+)]. YFP is expressed in the secondary vulval lineage (vulC, D) and CFP in the primary vulval lineage (vulE, F). egl-17::YFP from the pDRS17 plasmid (D. Sherwood and P. Sternberg). daf-6::CFP from the pCK1 plasmid (C. Kolditz and MA Felix). Slightly Egl, Pvl. unc-119(ed3) might still be present in the background.

ybIs733 [myo-3::egl-15::BGAR + lin-15(+)]. GFP/RFP chimeric expression of egl-15::BGAR reporter in body wall muscles.

Heterozygotes are WT and segregate WT, Bli Unc, and dead larva. vha-8(jh135) homozygotes are larval lethal.

ayIs9 [egl-17p::GFP + dpy-20(+)]. Reference: Tamayo JV, et al. BMC Genomics. 2013 May 4;14:304. doi: 10.1186/1471-2164-14-304. PMID: 23642123. lqIs221 is a Pegl-17::mab-5::gfp transgene. ayIs9 is a Pegl-17::gfp transgene. AQR migration defects. AQR in the tail in the normal position of PQR.

lqIs221 [egl-17p::mab-5::GFP + gcy-32p::CFP]. AQR migration defects. AQR in the tail in the normal position of PQR. CFP expression in AQR, PQR and URXL/R. Reference: Tamayo JV, et al. BMC Genomics. 2013 May 4;14:304. doi: 10.1186/1471-2164-14-304. PMID: 23642123.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. Rollers, red fluorescence in vulvae. YFP cannot be detected. lqIs58 [gcy-32::CFP] V. Reference: Josephson MP, et al. PLoS One. 2016 Feb 10;11(2):e0148658.

rdvIs1 [egl-17p::Myri-mCherry::pie-1 3'UTR + egl-17p::mig-10::YFP::unc-54 3'UTR + egl-17p::mCherry-TEV-S::his-24 + rol-6(su1006)] III. lqIs80 [SCMp::GFP::caax] IV. Rollers. GFP expression in seam cells. Red fluorescence in vulvae. YFP cannot be detected.

juIs76 [unc-25p::GFP + lin-15(+)] II. lqIs345 [egl-17p::mCherry + gcy-32p::CFP + scm::GFP]. VD/DD axon guidance defects. lq176 is a short isoform-specific allele of tom-1. Reference: Mahadik SS & Lundquist EA. Development 2023 Apr 1;150(7):dev201031. Doi: 10.1242/dev.201031. PMID: 37014062

Egl. Aldicarb-resistant.

ku194 is a loss of function allele, likely to be molecular null. Connection of gonad defective, >95% Egl. Anchor cell and uterine seam cell do not fuse. Males can mate. Hermaphrodites are very difficult to mate. Previously called cog-2(ku194).

kuIs29 [egl-13p::GFP + unc-119(+)] V. egl-13 is the new gene name for cog-2. Transcriptional fusion of GFP to egl-13 gene. Nuclear localized. Bright expression in body wall muscles, expressed in uterine pi lineage, extensive neuronal expression. Note that a very low penetrance Cog phenotype is seen in this strain. Transgenes with egl-13 promoter can cause Cog phenotype. Conflicting map data: Wendy Hanna-Rose mapped kuIs129 to the left of dpy-11; Shi lab reported it close to gon-10 and unc-76.

Egl. Unc slightly suppressed; the animals will usually back some. [unc-8(e15); egl-15(n484) animals are extremely Unc and will not back.]

Nuclear Ultrabright GFP::mNeonGreen Fluorescent protein (NuGFP) tag inserted downstream of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. NuGFP cassette is composed of an intercistronic region (ICR) from the C. elegans SL2-type operon, a SV40 nuclear localization sequence (NLS), the coding sequence of GFP, the coding sequence of mNeonGreen, and egl-13 NLS. The expression of NuGFP is tied to that of the endogenous daf-2, but after trans-splicing, the NuGFP protein is synthesized independently of DAF-2. This high-sensitivity daf-2 expression reporter was readily detectable in most C. elegans cells throughout development and adulthood. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

Egl. Variably Vul.

Egg laying defective. Makes bags of worms. Males mate.

Egg laying defective. Makes bags of worms. Males mate.

Egg laying defective. Most progeny released, but released late (lima bean or later). Males mate poorly.

Egg laying defective. Retains late stage eggs. Slow and Floppy; Long.

Egg laying defective. Retains late stage eggs. Partially temperature sensitive.

Egl.

Egg laying defective. Retains late stage eggs. Semidominant.

Egg laying defective. Retains late stage eggs. Temperature sensitive-non or weak Egl at 15C. Semidominant. Males mate. Sluggish and weak kinker.

Egl. Lon. Unc.

Long. Egl.