More Fields
Strain Species Genotype
CLP215 C. elegans twnEx8. Show Description
twnEx8 (mec-7p::tomm20::mCherry + myo-2p::GFP). Punctate mCherry signals denote mitochondria in six touch neurons. Pick animals GFP+ in the pharynx to maintain. Reference: Jiang HC, et al. Proc Natl Acad Sci U S A. 2015 Jul 14;112(28):8768-73.
DR1191 C. elegans daf-12(m20) unc-27(e155) egl-15(n484) X. Show Description
Dauer defective. Egl-60% form bags of worms. Unc-sluggish, poor backing. Resistant to both imipramine and serotonin. Slightly Dpy.
DR20 C. elegans daf-12(m20) X. Show Description
Defective dauer formation. Hermaphrodites accumulate oocytes. Males mate poorly.
DR205 C. elegans lon-2(e678) daf-12(m20) X. Show Description
Dauer defective. Long.
PS6192 C. elegans syIs243. Show Description
syIs243 [myo-3p::TOM20::mRFP + unc-119(+) + pBS Sk+]. Integrated from PS6053. Strain has been outcrossed, but not known if unc-119 mutation is still present in the background.
XE1220 C elegans wpEx76. Show Description
wpEx76 [myo-3p::tom20::tdKillerRed + unc-122p::GFP]. Pick GFP+ to maintain. KillerRed is a red fluorescent protein and photosensitizer that efficiently generates reactive oxygen species (ROS) when activated by light. wpEx76 carries a tandem dimer version of KillerRed targeted to the mitochondria by the addition of a tom-20 targeting sequence (mito-tdKillerRed). Reference: Williams DC, et al. Cell Rep. 2013 Oct 31;5(2):553-63.
ZM7696 C. elegans hpIs376. Show Description
hpIs376 [unc-25p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM7798 C. elegans hpIs372. Show Description
hpIs372 [acr-5p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM8607 C. elegans hpIs481. Show Description
hpIs481 [ceh-12p::tomm20::miniSOG::SL2::BFP + unc-129(DB)p::tomm20::miniSOG::SL2::BFP + lin-15(+)]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. unc-129(DB)p is a fragment of the unc-129 promoter driving expression in only DB motor neurons (described in Colavita et al., Science 1998 31;281(5377):706-9). The ceh-12 promoter drives expression in VB motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9062 C. elegans hpIs583. Show Description
hpIs583 [acr-2(s)p::tomm20::miniSOG::SL2::RFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of A- and B-class motor neurons. During neuron ablation, it is recommended to keep the lid of the plate open and use a heat disipator to keep the air cool. acr-2s(p) is a 1.8 kb fragment of the acr-2 promoter driving expression in only A- and B- class motor neurons (described in Jospin et al, 2009 PLoS Biol. Dec;7(12):e1000265). Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
ZM9123 C. elegans hpIs590. Show Description
hpIs590 [ttr-39p::tomm20::miniSOG::SL2::BFP]. Maintain in the covered box to avoid unnecessary exposure to ambient light. Stimulation with blue light (460 nm LED light for 30 min at 4 Hz with 2 mW/mm2), induces mitochondrial-miniSOG ablation of D-class motor neurons. Generated in N2 background. Reference: Gao S, et al. eLife 2018 Jan 23;7:e29915. doi: 10.7554/eLife.29915.
AUM2023 C. elegans daf-2(e1370) unc-119(ed3) III; vizIs23. Show Description
vizIs23 [pie-1p::GFP::daf-2(WT)::pie-1 3'UTR + unc-119(+)]. Maintain at 15C; pick superficially wild-type animals to avoid silencing of the transgene. pie-1 driven DAF-2 coding region with GFP transgene rescues the germline defects of daf-2(e1370). Slow growing. The transgene is sometimes silenced in the germline resulting in dauerunc animals at 25C. Reference: Lopez AL 3rd, et al. Dev Cell. 2013 Oct 28;27(2):227-40.
AUM2059 C. elegans vizSi20 II; unc-119(ed3) III. Show Description
vizSi20 [mex-5p::GFP::gsk-3 (K65A,E77A,D161A,D180A)::tbb-2 3’UTR + unc-119(+)] II. Superficially wild-type. vizSi20 was inserted into Chr II ttTi5605 using MosSci. GSK-3 cDNA was rendered kinase dead by replacing K65, E77, D161 and D180 to alanine. The transgene does not rescue gsk-3 sterility or embryonic lethality defects. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
AUM2071 C. elegans vizSi32 II; unc-119(ed3) III. Show Description
vizSi32 [cdk-2p(intron)::GFP::tbb-2 3’ UTR + unc-119(+)] II. vizSi32 was inserted into ttTi5605 on Chr II using MosSci. Intron 1 of cdk-2 drives drives GFP expression in this transgene. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
AUM2073 C. elegans vizSi34 II; unc-119(ed3) III. Show Description
vizSi34 [cdk-2p::GFP::tbb-2 3’ UTR + unc-119(+)] II. Superficially wild-type. vizSi34 was inserted into ttTi5605 on Chr II using MosSci. Predicted cdk-2 promoter (from WormBase) drives GFP expression. Reference: Furuta T, et al. Development. 2018 May 14;145(10). pii: dev161042. doi: 10.1242/dev.161042.
CB7174 C. elegans ptr-15(e2710e3062) V. Show Description
Intragenic missense revertant. Partly resistant to Leucobacter Verde1. Reference: Stroud et al. (2013) IWM2013Abstract. ptr-15 also known as bus-13.
EM207 C. elegans tbx-2(bx59) III; him-5(e1490) V. Show Description
Conditional lethal: inviable when grown at 25C. Wild type at 16C. Viable when grown at 20C; partial ray loss at 20C. Shifting males during ray assembly to non-permissive temperature results in ray loss. No lineage defect.
FAS43 C. elegans his-69&his-70(uge44) his-72(tm2066) III; his-74(uge18) V; his-71(ok2289) X. Show Description
Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].
FX11507 C. elegans rabs-5(tm2036) IV/nT1 [qIs51] (IV;V). Show Description
Heterozygotes are WT with pharyngeal GFP signal, and segregate arrested nT1 aneuploids, and non-GFP tm2036 homozygotes. tm2036 homozygotes are temperature sensitive lethal, and can be maintained as homozygotes at 15C. tm2036 homozygotes have endocytosis defects in oocytes and coelomocytes at 25C. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
FX2066 C. elegans his-72(tm2066) III. Show Description
Homozygous viable and fertile. Attribution: This strain was generated by the National Bioresource Project at the Tokyo Women's Medical University School of Medicine, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
GM209 C. elegans Show Description
C. elegans wild isolate. Isolated in Seville, Spain by Patricia Rios Castano and Manuel Jesus Munoz Ruiz.
MQ1333 C. elegans nuo-6(qm200) I. Show Description
Slow biological timing (pharyngeal pumping, defecation, development). May grow better at 15C. Reference: Yang W & Hekimi S (2010) Aging Cell March 19.
NM204 C. elegans snt-1(md290) II. Show Description
snt-1 encodes the C. elegans homolog of synaptotagmin I. md290 is a deletion that removes most of the coding sequence. Strain is a slow growing aldicarb resistant (Ric) Unc. Males won't mate.
NM2040 C. elegans dhc-1(js121) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); jsIs37 V. Show Description
jsIs37 [mec-7p::snb-1::GFP) + lin-15(+)]. snb-1::GFP expression in a subset of mechanosensory neurons; GFP is faint and can only be seen on a compound microscope. Heterozygotes are GFP+ in the pharynx. dhc-1 homozygotes are GFP- and sterile or partially sterile pvuls. Homozygous sterile mutation balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP js121 homozygotes. Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.
RM2005 C. elegans unc-75(md1344) I. Show Description
Small, coily Unc; aldicarb resistant. 780-bp deletion: TTCGGTTCGTGTTTTTTATTGATATTTTTT /-----/ACAACATCCATTCGTCACAAGCTGCTATCA. Reference: Loria PM, et al., Curr Biol. 2003 Aug 5;13(15):1317-23.
SP1732 C. elegans osm-6(m201) V. Show Description
TG2228 C. elegans polq-1(tm2026) III. Show Description
Superficially wild-type. Deletion site verified by PCR. Reference: Muzzini DM, et al. DNA Repair (Amst.) 2008 Jun 1;7(6):941-50.
VC1607 C. elegans nlr-1(tm2050) IV/nT1 [qIs51] (IV;V). Show Description
F20B10.1. Homozygous lethal deletion chromosome balanced by GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2050 homozygotes (early larval arrest). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: CAGTTCTGTGACGTCCCAGT. External right primer: GTCGGCGTTAGATGACTATG. Internal left primer: TACGGCAAAGTGAATGGCTT. Internal right primer: ACAGCTGATCTACCACACTC. Internal WT amplicon: 1775 bp. Deletion size: 1078 bp. Deletion left flank: CAATGAGTTAATTTCCAACAAAATTATTTT. Deletion right flank: GTAAGTGAGTACCGAACTGCTCCGGGCTTA. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VZ12 C. elegans trxr-2(tm2047) III. Show Description
Superficially wild-type. tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ14 C. elegans trxr-2(tm2047) III; trxr-1(sv47) IV. Show Description
sv47 deletion removes bases 721-2383 of the trxr-1 genomic sequence (as measured from the start of the trxr-1 coding sequence). tm2047 removes bases -128 to +380 relative to the start of the trxr-2 coding sequence (removing part of the proximal promoter). tm2047 outcrossed 6x. sv47 outcrossed 10x. Reference: Cacho-Valadez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
VZ17 C. elegans trxr-2(tm2047) III; trx-2(tm2720) V. Show Description
Superficially wild-type. Reference: Cacho-Valdez B, et al. Antioxid Redox Signal. 2012 Jun 15;16(12):1384-400.
WM205 C. elegans unc-119(ed3) III; neIs22. Show Description
neIs22 [wago-1::GFP + unc-119(+)]. Maintain at 24 C to avoid silencing of GFP expression. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
WM206 C. elegans drh-3(ne4253) I. Show Description
Mutator. Dominant RNA-i deficient. Temperature sensitive sterile. Maintain at 15-20 C. ne4253 is a C-to-T transition at position 3896 of the genomic DNA with respect to the +1 position of the ATG creating a T834M missense mutation. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
WM207 C. elegans mut-7(ne4255) III. Show Description
Dominat RNAi deficient. Temperature-sensitive sterile. E439K mutation in conserved Mg2+ coordinating residue. Reference: Gu W, et al. Mol Cell. 2009 Oct 23;36(2):231-44.