Search Strains

NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] Reference: Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.

bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91.

NOTE: Supplement media to 50 mM Mg2+ and grow at 15C for maximum fertility. The stock will propagate on non-supplemented media at 20 degrees, but this will potentially select for intragenic revertants of gon-2(q388). Temperature-sensitive failure of gonad precursor divisions. Penetrance of Gon phenotype is very high at 23.5C. At 25 degrees you can expect reduced brood sizes and some embryonic lethality. [Note: temperature sensitive period for gon-2(q388) begins prior to fertilization.] bc364 deletes 1,109 bp between AACATCTTGAATAACCATTCGGGAAGT and AAGTCATTCATTGCAGAGCTTACATTTAGTA. References: Kemp BJ, et al. Genetics. 2009 Feb;181(2):581-91. Sun AY & Lambie EJ. Genetics. 1997 Nov;147(3):1077-89.

om33 chromosome contains a linked fer-6 allele and a linked Mel. Mel probably not associated with om33, but they have not been separated. Best grown at 15C.

omIs1 [met-2p::met-2::GFP + Cbr-unc-119(+)] II. Reference: Yang B, et al. PLoS Genet. 2019 Feb 22;15(2):e1007992. doi: 10.1371/journal.pgen.1007992. PMID: 30794539.

ubr-5(om2) is a deletion predicted to severely truncate the UBR-5 protein. ubr-1 also known as sog-1. Reference: Safdar K, et al. G3 (Bethesda). 2016 Jul 7;6(7):2125-34. doi: 10.1534/g3.116.027805. PMID: 27185398.

3xFlag tag inserted at N-terminus of endogenous met-2 locus using Crispr/Cas9. Reference: Mutlu B, et al. Sci Adv. 2018 Aug 22;4(8):eaat6224. doi: 10.1126/sciadv.aat6224. PMID: 30140741.

Dpy. Abnormal rays.

Temperature sensitive. Missing Ray. Swollen tail and reduced fan. Temperature sensitive lethal at all stages. Wrinkled spicule.

Unc. Abnormal rays. bx25 previously called ram-4.

lep-2/Y55F3AM.6 reference allele. Him. Reference: Herrera RA, et al. Development. 2016 Mar 1;143(5):799-809. doi: 10.1242/dev.132738. PMID: 26811380.

Paralyzed Unc. Throws males. hlh-2(bx115) has no phenotype in this background.

Mos1 transposon insertion in LG I. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR261 (Chr I 5'gaaatagagggcagttcaacg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.

Mos1 transposon insertion in LG X. Presence of Mos1 can be detected using oligos oJL115 (Mos1 5'gctcaattcgcgccaaactatg3') and oVR266 (Chr X 5'gacaaagacgtgtagttgcg3'). Reference: Giordano-Santini R, et al., (2010) Nature Methods. Aug 22.

muIs61 [(pKL78) daf16::GFP + rol-6(su1006)]. muIs61 rescues daf-16(mu86). muIs61 is a gamma-induced insertion of muEx50. Derived from RB1739 and CF1139.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Single copy transgene inserted into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. Degron and emGFP tag inserted into endogenous smc-3 locus. Derived by crossing parental strains PHX5520 with CA1200. Reference: https://www.biorxiv.org/content/10.1101/2023.09.18.558239v1.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID*::GFP tag inserted into the endogenous dpy-27 locus. Dumpy, Him, X chromosome dosage compensation hypomorph. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted into the endogenous top-2 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. AID* tag inserted at the end of exon five in the endogenous top-1 locus. ieSi57 is a single-copy transgene insertion into chromosome II (oxTi179) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in the soma. This strain can be used for auxin-inducible degradation (AID) of target proteins in somatic tissues. Reference: Morao AK, et al. Mol Cell. 2022 Nov 17;82(22):4202-4217.e5. doi: 10.1016/j.molcel.2022.10.002. PMID: 36302374.

Full CRISPR deletion of rcs-1 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

jy110 is a CRISPR-engineered deletion removing the entire drh-1 coding sequence. Susceptible to viral infection. Defective in inducing the intracellular pathogen response upon viral infection. Reference: Sowa JN, et al. J Virol. 2020 Jan 6;94(2):e01173-19. doi: 10.1128/JVI.01173-19. PMID: 31619561.

Full CRISPR deletion of fbxa-75 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

Full CRISPR deletion of fbxa-158 via CRISPR in a dpy-10 background, outcrossed 3x to wild-type. Superficially wild-type. Reference: Panek J, et al. Proc Natl Acad Sci USA. .2020 Apr 7;117(14):7950-7960. doi: 10.1073/pnas.1918417117. PMID: 32193347.

GFP tag inserted into the N-terminus of endogenous dao-5 locus. maintain at 16-20C. Nucleolar GFP expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi60 [myo-2p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in pharyngeal muscle. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi61 [ges-1p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in the intestine. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Maintain at 15-20C. AID* and GFP tag inserted at the N-terminus of the endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in germ line and early embryos. Reference: Zhao Q, et al. PLoS Biol. 2023 Aug 31;21(8):e3002276. doi: 10.1371/journal.pbio.3002276. PMID: 37651423.

mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Maintain at 16-20C. Nucleolar mKate2 expression. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N terminus of endogenous rpoa-2 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at C-terminus of endogenous grwd-1 locus. mKate2 tag inserted into the C-terminus of endogenous nucl-1 locus. Nucleolar mKate2 expression. This strain can be used for auxin-inducible degradation (AID) of GRWD-1 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at N-terminus of endogenous rpoa-2 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-2 in somatic tissues in a set-2 mutant background. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

wrdSi23 [eft-3p::TIR1:F2A:mTagBFP::tbb2 3' UTR:: loxP] I. Maintain at 16-20C. AID*::GFP tag inserted at the C-terminus of the endogenous rpoa-1 locus. This strain can be used for auxin-inducible degradation (AID) of RPOA-1 and UNC-104 in somatic tissues. Reference: Mejia-Trujillo R, et al. bioRxiv 2025.05.07.652530; doi: https://doi.org/10.1101/2025.05.07.652530.

fphIs1 [aak-2Ap::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed with its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx1 [aak-2Cp::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2C isoform expressed from its own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx2 [aak-2A/Cp::aak-2A/C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2A and aak-2C isoforms expressed from their own promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx3 [aak-2Ap::aak-2C::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2c isoform expressed from the aak-2a promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphIs2 [unc-119p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal unc-119 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphIs3 [rab-3p::aak-2A::GFP + unc-119(+)]. aak-2A isoform expressed from the neuronal rab-3 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

fphEx4 [vha-6p::aak-2A::GFP + unc-119(+)]. Pick wild-type (non-Unc) to maintain. aak-2A isoform expressed from the intestinal vha-6 promoter in aak-2(ok524) background. Reference: Jeong JH, et al. Nat Commun. 2023 Jan 18;14(1):288. doi: 10.1038/s41467-023-35952-z. PMID: 36653384.

ekIs2 contains [pie-1p::GFP::cyb-1 + unc-119(+)]. Translational fusion of CYB-1 expressed from the pie-1 promoter and including the pie-1 3'UTR. GFP::CYB-1 expression in the proximal gonad, with staining disappearing in the zygote. Maintain at 25°C.

Appears WT. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 20C or above. Below 20C the GFP signal turns off.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. apo-5(or358) is temperature-sensitive embryonic lethal. 100% dead embryos when L4 larvae are shifted to 26.6C. A small percentage of embryos survive form L4 larvae shifted to 25-26C. or358 appears to be semi-dominant; L4 or358/+ heterozygotes shifted to 26C produce ~20% embryonic lethality. Maintain at 15C. References: Encalada SE, et al., Mol Biol Cell. 2005 Mar;16(3):1056-70. Strome S, et al. Mol Biol Cell. 2001 Jun;12(6):1751-64.

Dominant, conditional, maternal-effect. At 15C, almost all embryos hatch from or346/+ and or346/or346 mothers. At25C, about 85% of embryos die from or346/+ mothers and about 100% of embryos die from or346/or346 mothers.

Temperature sensitive. Maintain at 15C. At 26C, animals give rise to 99% dead embryos, with embryos exhibiting lack of pronuclear migration at the one-cell stage. At 15C, animals give rise to 73% dead embryos.

Strain is homozygous viable due to redundancy of act- and act-3 genes. AT 15C, all embyros produced by homozygous mothers hatch; at 26C, 88% of embryos hatch. Deletion which removes 544 nucleotides of act-2 plus the predicted 3' UTR and 705 nucleotides 3' of that. This removes 163/376 amino acids of the act-2 sequence (calculated with ATG methionine included). Sequence of deletion is (text inside of slashes is deleted, with 5' and 3' sequences shown): (exon#2)5'....gtgaaatcgtgcgtgacatc/aaggagaagctttgtt........ ...tggatagacattggtgt/gcgcactccttctggat.....3'(872 nucleotides from stop codon). Removes 489/1131 coding base pairs, beginning in second exon and extending beyond the 3' UTR.

orIs17 [dhc-1p::GFP::dhc-1 + unc-119(+)]. N-terminal-tagged GFP::dhc-1 fusion driven by the dhc-1 promoter. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.

orIs14 [pie-1p::GFP::efa-6c::pie-1 3'UTR + unc-119(+)]. pie-1 promoter-driven N-terminal GFP fusion to EFA-6 isoform C. Reference: O'Rourke SM, et al. Nat Cell Biol. 2010 Dec;12(12):1235-41.

orIs19 [pie-1::GFP::dylt-1 + unc-119(+)]. Superficially wild-type. Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.