Search Strains

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which produce only dead eggs at 25C but viable progeny at 15C. Throws males.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. tim-1 is temperature sensitive: progeny are viable at 15C, and dead at 25C. Previously called csg-5(t1545). Received new stock 5/04.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, Dpy Steriles, and Uncs which are Mel with over 99% embryonic lethality.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, Uncs which produce dead eggs, and Dpy Steriles. Throws males.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, Dpy Steriles, and embryonic lethals. Throws males. t1478 PKA arm-5.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. zyg-8(t1638) pka apo-1(t1638). SeeWBPaper00005199.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. Received new stock 3/01. See also WBPaper00005208.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, Sterile Dpys and Uncs which give only dead eggs. Throws males.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1550 pka pnm-1(t1550).

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. t1440 previously called mel-27.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles and Uncs which give only dead eggs. This strain was mistakenly called emb-30 in the paper; it is not an emb-30 allele.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs. tbg-1(t1465) previously called sas-3(t1465).

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

Heterozygotes are WT and segregate WT, DpySteriles, and Uncs which give only dead eggs.

N-terminal tag of JNK-1 via CRISPR/Cas9 knock-in of mNeonGreen at jnk-1 locus. Insertion verified by PCR and fluorescence. Left flank: 5' cagcaagttaaagtgtgtgatcctgtgcac 3'; Right flank: 5' ATGGAGGAACGATTATCCACAACATCATCG 3’; gRNA: gtgtgatcctgtgcacATGG; Cas9/sgRNA plasmid: pGLOW114a; mNG^SEC^3xFlag plasmid: pGLOW116; SEC insertion allele strain: GLW76.

pgEx116 [unc-70::TSmod + myo3p::mCherry]. Pick animals with red fluorescence in body wall muscle to maintain array. The tension sensor module (TSMod) was inserted into the coding sequence of unc-70. TSmod consists of a donor (mTFP) and acceptor (Venus) fluorophore separated by a flexible linker made of 40 residues from the spider-silk flagelliform, which acts as an entropic nanospring suitable for estimating biologically relevant forces. Reference: Krieg M, et al. Nat Cell Biol. 2014 Mar;16(3):224-33.

age-1(mg44) homozygotes throw all dauers at all temperatures (maternal effect dauer constitutive); can be rescued zygotically. age-1(mg44) homozygous animals that are maternally rescued for dauer formation are long-lived. mg44 is a Trp405 Amber mutation. Heterozygotes are WT and segregate WT (1/3 of which throw only dauers) and DpyUncs.

mgEx373 [unc-119p::daf-2(cDNA)::unc-54 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Reference: Wolkow CA, et al. Science. 2000 Oct 6;290(5489):147-50.

mgSi3 [(pCMP2)ubl-1p::GFP::ubl-1-3'UTR + Cbr-unc-119(+)] IV. Strong ubiquitous GFP expression. Can be used as a control for a strain containing an endogenous siRNA sensor (GR1720). Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi4 [(pCMP2)ubl-1p::GFP::siR-1-sensor-ubl-1-3'UTR + Cbr-unc-119(+)] IV. Very weak ubiquitous GFP expression. The 22G siR-1 sensor transgene is more sensitive to gene inactivations that affect 22G siR-1 levels when grown at 25C compared to 20C. Reference: Montgomery TA, et al. PLoS Genet. 2012;8(4):e1002616.

mgSi2 [mut-16p::mut-16::GFP::mut-16 3'UTR + unc-119(+)] IV. MosSCI integrant of mut-16::GFP rescues pk710. Reference: Phillips CM, et al. Genes Dev. 2012 Jul 1;26(13):1433-44.