Search Strains

let-99(or204) is temperature-sensitive, maternal-effect, embryonic-lethal. Nearly completely penetrance of lethality at 26C. Viable at 15C. Maintain at 15C. Reference: Goulding MB, et al. J Cell Biol. 2007 Sep 24;178(7):1177-91.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs13 [pie-1p::GFP::npp-22(genomic)::pie-1 3'UTR + unc-119(+)]. GFP-tagged NPP-22. Superficially wild-type. Might still carry unc-119(ed3) in background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: O'Rourke SM, et al. PLoS Genet. 2007 Aug;3(8):e128.

orEx15 [pie-1p::GFP::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. pie-1 promoter-driven N-terminal GFP fusion to RFL-1. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.

orEx16 [rfl-1p::tdTomato::rfl-1(genomic) + unc-119(+)]. Pick non-Unc to maintain. N-terminal tdTomato fusion to RFL-1 driven by rfl-1 promoter. Reference: Dorfman M, et al. Genetics. 2009 Aug;182(4):1035-49.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

itIs153 [pie-1p::par-2::GFP + rol-6(su1006) + N2 genomic DNA]. ojIs1 [pie-1p::GFP::tbb-2 + unc-119(+)]. Maintain at 15C. Temperature-sensitive embryonic-lethal at restrictive temperature of 26C; viable at permissive temperature of 15C. Reversed AP polarity axis at restrictive temperature with par-2::GFP and tubulin::GFP expression. itIs153 is an integrated derivitive of axEx1094. Reference: Keikhaee MR, et al. PLoS One. 2014 Sep 4;9(9):e106484.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. orIs1 [pie-1p::GFP::mei-1 + unc-119(+)]. Maintain at 25C to retain transgene fluorescence. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

itIs37 [pie-1p::mCherry::H2B::pie-1 3'UTR + unc-119(+)] IV. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Temperature-sensitive embryonic lethal. Maintain at 15C. Shift to 25-26C for 2-6 hours to induce meiotic spindle phenotype. Reference: Connolly AA, et al. J Cell Biol. 2015 Sep 14;210(6):917-32. PMID: 26370499

sas-7(or1940[gfp::sas-7]) III. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Green centriole signal and red chromosome signal. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Sugioka, et al., 2017 Elife 6 e20353.

ijmSi3 [mex-5p::cls-2(re-encoded)::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The coding sequence of GFP-tagged cls-2 in the transgene was re-coded using silent mutations to render it insensitive to RNAi-depletion of endogenous cls-2 expression. mCherry expression marks histones. Not known if unc-119(ed3) is still carried in the background of this strain. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Schlientz A and Bowerman B. PLoS Genet. 2020 Oct 7;16(10):e1008751. doi: 10.1371/journal.pgen.1008751.

ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Superficially wild-type. mKate2 was inserted into the C-terminus of ebp-2 endogenous locus. Reference: Sugioka K, et al. (2018) PNAS, Jan 30;115(5): E954-E963. (PubMed ID: 29348204)

ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. Maintain at 15C. Fast-acting temperature-sensitive allele. At restrictive temperature (26C), animals give rise to 100% dead embryos. At 15C, animals give rise to viable progeny. GFP::aspm-1 localizes to meiotic spindle poles and centrosomes during early development. Might still carry unc-119(ed3) III in background. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry klp-15/16 homozygotes. Homozygous double deletion mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous tac-1 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. GFP tag inserted into endogenous zyg-9 locus. Might still contain unc-119(ed3) in the background. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. GFP tag inserted into endogenous aspm-1 locus. tmC18 balancer marked with myo-2p::mCherry and Dpy. Heterozygotes are wild-type with pharyngeal mCherry, and segregate mCherry+ heterozygotes, tmC18 homozygotes (mCherry+ Dpy) and non-mCherry triple mutant homozygotes. Homozygous triple mutants are fertile but produced reduced brood sizes with highly penetrant embryonic lethality; will also segregate some males. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Chuang CH, et al., Biology Open 2020 9: bio052308 doi: 10.1242/bio.052308 Published 25 June 2020

umnIs32 [myo-2p::GFP + NeoR, II: 11755713 (intergenic)] II. or1985 is a CRISPR/Cas9 engineered deletion of zyg-9 removing the entire open reading frame. Heterozygotes are wild-type and GFP+ and segregate WT GFP+ (hets), or1948 homozygotes (GFP-, lay 100% dead embryos) and paralysed DpyUnc GFP+ (mnC1 homozygotes). Maintain by picking WT GFP+. Reference: Harvey AM, et al. PLoS Genet. 2023 Jan 6;19(1):e1010363. doi: 10.1371/journal.pgen.1010363. PMID: 36608115

Temperature sensitive maternal effect lethal mutation in F11H8.1 (Nedd8 activating enzyme). Permissive temperature is 15C, restrictive temperature is 25C. Embryos layed at restrictive temperature have spindle-orientation defects due to the mis-localization of MEI-1/MEI-2 to the mitotic spindle. Additionally, ectopic cleavage furrows are initiated during cytokinesis, and cell-cycle delays are apparent during interphase.

Homozygous or195 hermaphrodites make 100% dead embryos at 26C. One-cell embryo has a very small but bipolar spindle, severe chromosome segregation defect. Maintain at 15C. Previously called spd-4. 2/06: From Bruce Bowerman: The or195 mutation changes base 10,679 of the cosmid clone T21E12 from a C to a T. This corresponds to dhc-1 cDNA nucleotide 9599 (WS153) , which is the center nucleotide of codon 3200. This codon changes from Serine in N2 to Leucine in or195 (S3200L). Note: this is not the same mutation for or195ts that we reported in Hamill et al, 2002(Dev Cell 3, 673-684). The mutation reported in our paper is not present in this strain. We apologize for the confusion. The pairs dhc-11a,b amplify the mutated fragment in dhc-1(or195). The mutation is near the center of this fragment; a clean (gel purified) DNA prep helps get a good read of it. dhc-11b: 5' aacagacgcacgattgacct 3'. dhc-11a: 5' ctcaaatcaaggaaggagct 3'. PCR conditions: 5 min at 94 degrees C; 30 sec at 94 degrees C; 30 sec at 55 degrees C; 1 min at 72 degrees C. 35 Cycles using Taq polymerase.

Reference: Gracida X, Eckmann CR. Curr Biol. 2013 Apr 8;23(7):607-13.

efEx12 [glp-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. GFP expression in the proliferative region of the germ line (resembling endogenous GLP-1 protein localization), and also in spermatheca and other somatic tissues. Derived by bombarding strain DP38 with LAP-tagged glp-1 fosmid (WRM0630DF02).

efIs155 [mex-5p::rpl-4::FLAG::tbb-2 3?UTR + Cbr-unc-119(+)] II. Tagged RPL-4 can be used for ribosome purifications from germ cells. Reference: Nousch M, et al. G3 (Bethesda). 2020 Sep 3:g3.401644.2020. doi: 10.1534/g3.120.401644

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Null mutation: premature STOP codon and frame shift. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Deletion of all genes coding H3.3 histone variant. Superficially wild-type with slight reduction of brood size at 25C. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Deletion of his-69 and his-70; complex substitution with an insertion at break site: aacaaatcagttctcacttttagcc-TCTTGGATTTAATAAATAAATTA-agtttaagtttccgccaatgaaaaa. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

Superficially wild-type. Reference: Delaney K, et al. Genetics. 2018 Apr 10. pii: genetics.300909.2018. doi: 10.1534/genetics.118.300909. [Epub ahead of print].

zzIs16 [(pJE3) eff-1p::GFP + rol-6(su1006)]. GFP+ Rollers. Chromosomal insertion of zzEx10. Integration site of zzIs16 not yet mapped, but it is not tightly linked to eff-1 II, unc-119 III, or jcIs1 IV. pJE3 has 7.5 kb of eff-1 upstream sequence inserted into pPD95.75, driving cytoplasmic GFP expression.

Hypomorphic allele. Fully viable and fertile. Strongly uncoordinated larvae, tend to coil backward. Dpyish, mildly Unc adults. Isolated out of a mutator strain also containing uncharacterized e2281 and e2282.

fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

fgpIs21 [(pFGP80) pie-1p::mCherry::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. May be used to follow unconjugated SUMO localization within the germline and embryo. When compared with strain FGP1, the difference in fluorescence signal corresponds to SUMO conjugation in FGP1. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

gei-17(fgp1[GFP::FLAG::AID*::loxP::gei-17]) I. ieSi38 [sun-1p::TIR1::mRuby::sun-1 3'UTR + Cbr-unc-119(+)] IV. Single copy transgene inserted into chromosome IV (cxTi10882) expressing modified Arabidopsis thaliana TIR1 tagged with mRuby in germ line and early embryos. Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.

fgpIs23 [(pFGP78) pie-1p::GFP::TEV-S-Tag::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

gei-17(fgp1[GFP::FLAG::degron::loxP::gei-17]) I. ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. [NOTE: the ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV transgene was previously annotated as itIs37 in this strain. The correct name of the transgene is ltIs37 and not itIs37.] Reference: Pelisch et al. Mol Cell. 2017 Jan 5;65(1):66-77.

fgpIs24 [(pFGP77) pie-1p::GFP::TEV-S-Tag::smo-1(GA) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal. When compared with strain FGP3, the difference in fluorescence signal corresponds to SUMO conjugation in FGP3. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

ruIs57 [pie-1p::GFP::tubulin + unc-119(+)]. Expression of GFP::tubulin fusion in germline and early embryos. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

ruIs32 [pie-1p::GFP::H2B + unc-119(+)] III. Expression of GFP::H2B histone fusion in germline. fgpIs20 [(pFGP79) pie-1p::mCherry::smo-1(GG) + unc-119(+)]. Propagate at 20-25°C. Switching to 25C prior to imaging may enhance the signal from fgpIs20. Allows SUMO localization/conjugation to be observed within the germline and embryos. Reference: Pelisch et al. Nat Commun. 2014 Dec 5;5:5485.

wzIs20 [lgc-55p::GFP + lin-15(+)]. lgc-55 regulatory sequences drive expression of GFP in neurons, GLR cells and some muscles. Reference: Ringstad N, et al. Science. 2009;325(5936):96-100. doi:10.1126/science.1169243

xnIs449 [lin-26::lifeAct::GFP + unc-119(+)]. LifeAct-GFP expressed in epidermal cells of embryos. In adults, expression is also observed in pharynx and some cells in the tail. Reference: Zilberman, Y., J. Abrams, D.C. Anderson, and J. Nance. 2017. Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis. J Cell Biol 216: 3729-3744.

xnIs459 [YFP::ral-1a + unc-119(+)] III. Expresses YFP::ral-1 maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnIs461 [sec-5::YFP + unc-119(+)]. Expresses sec-5::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Rescues maternal-effect lethality of sec-5(pk2358). Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnSi31 [sec-8::mCherry + unc-119(+)] II. Expresses sec-8::mCherry maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnIs23 [cdc-42p::ZF1::GFP::cdc-42 + unc-119(+)]. Transgene insertion expressing ZF1::GFP::CDC-42 ubiquitously in somatic cells. Transgenic cdc-42 protein subject to ZIF-1-dependent degradation. Might still have unc-119(ed3) in the background. Reference: Armenti STet al. Development. 2014 Dec;141(23):4640-7. doi: 10.1242/dev.115048. Epub 2014 Nov 5. PMID: 25377555.

xnIs484 [mCherry::sec-10 + unc-119(+)]. Expresses mCherry::sec-10 maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnSi34 [sec-15::YFP + unc-119(+)] II. Expresses sec-15::YFP maternally and zygotically. Expression is present in many cells, including early embryos, epithelial cells, the excretory cell, and the germ line. Transgene was inserted by MosSCI into ttTi5605 excision site. Derived from WM186. Reference: Armenti ST, Chan E, Nance J. Dev Biol. 2014 Aug 4. pii: S0012-1606(14)00355-8.

xnIs502 [pie-1p::GFP::jac-1 + unc-119(+)]. Maintain at 25C to slow silencing of transgene. GFP::JAC-1 localized at contacts in early embryos. Reference: Klompstra D, et al. Nat Cell Biol. 2015 Jun;17(6):726-35.