Search Strains

Sister cells of NSM neurons fail to undergo programmed cell death. Other cell deaths unaffected. 60% penetrance at 25C; 10% penetrance at 15C.

Vul. Strong loss of function allele.

Strong allele of ced-9. Reference: (1999) Genetics 153(4):1655-71.

At 20C about 50% of the hermaphrodites are Egl.

Non-Lethal allele of let-60. Clear. Suppresses n765. Maintain at 15C.

Animals with ctDp6 are WT and throw WT and dead eggs.

Heterozygotes are WT and segregate WT, Uncs and DpySte. n2161 is an intragenic revertant of ced-9(n1950). The unc-69 ced-9 homozygotes have a maternal effect lethal phenotype: their offspring arrest as embryos or L1; they also give very few eggs at 25C.

Animals with the Duplication are WT. Animals which have lost the Duplication are Dpy and Twitchers. Throws both WT and DpyTwitcher males. Maintain by picking WT.

Egl - Bag, Con. Strong allele of sem-4.

Unc. Null allele of unc-76.

Unc. Weak allele of unc-76.

Con, Shk(ts). Weak allele of unc-25.

Gain-of-function allele. Spontaneous shrinker, jerky, Unc. G925A, V309M in the pore lining domain. References: Jospin M, et al. PLoS Biol. 2009 Dec;7(12):e1000265. Stawicki TM, et al. Curr Biol. 2011 May 24;21(10):883-8.

n2433 is a suppressor of ced-9(n1950n2161).

cdf-1(n2527) suppresses the let-60(n1046gf) Muv phenotype from 95% Muv to <5% Muv. Suppression is weakly semi-dominant.

Wide, meandering excretory canals, with some septate fluid-filled cysts. Canal enlargement visible from L1 through adult. Defect visible only by Nomarski microscopy. n2669 was originally listed as an allele of exc-5. Later repeated complementation tests showed n2669 to be an allele of a novel locus positioned close to exc-5.

Heterozygotes are WT and segregate WT, steriles with a vulval defect, and scrawny Dpys. n2679 is a suppressor of let-60(n1046) Muv, and is recessive sterile with vulval defects. n267 is an intermediate strength allele. See also WBPaper00002150.

Maintain by picking wild-type animals raised at 25C. Heterozygotes will be wild-type and segregate wild-type, Unc, and Sterile Muv. The phenotype of homozygous lin-13 hermaphrodites segregating from a heterozygous mother depends on the temperature at which the strain was grown. At 25C, homozygous hermaphrodites segregating from a heterozygote are both Muv and sterile. At 20C, ~1/2 of hermaphrodites segregating from a heterozygote are sterile, but only a few are Muv. At 15C, hermaphrodites segregating from a heterozygote are almost wild type in appearance and fertility. However, if the progeny of these 15C animals are grown at 15C, all are sterile and some are Muv. If the progeny of these 15C animals are grown at 25C, then some animals arrest during larval growth and the rest are both sterile and Muv. Reference: Ferguson EL & Horvitz HR. Genetics. 1985 May;110(1):17-72. PMID: 3996896.

n1760: strong allele of lin-39, vulvaless (n300-like). n945: HSN-. Egl. Coiler.

n2812 is a strong loss-of-function allele and a maternal effect lethal.

Weak allele of sqv-7. mid-L4 vulva abnormal. Somewhat sterile.

Pick WT to maintain strain. Dp lost at high frequency, usable for mosaic analysis. Animals without the Dp are Unc, Vul and Ncl.

Suppressor of ced-9(n1950 n2162). Reference: (1999) Genetics 153(4):1655-71.

Wild type phenotype. e1500 rubberband phenotype is suppressed by the loss-of-function n234 mutation.

nIs51 [egl-10(+) + lin-15(+)] X. Egl-C, Bor, hyperforaging, hyperactive locomotion, and male longevity and mating reduced. By Western blotting and staining the EGL-10 protein is highly overexpressed relative to N2. nIs51 was generated by injecting the lin-15 rescuing plasmid pEK1 at 50 ug/ml and the egl-10 rescuing fragment pMK21 at 80 ug/ml into MT1642 lin-15(n765) worms. The resulting strain was gamma irradiated and an integrant isolated, and was backcrossed to N2 four times. nIs51 was mapped to the right arm of X.

Suppressor of ced-9(n1950n2161) maternal effect lethality.

Medium strong allele. Suppressor of ced-9(n1950n2161) maternal effect lethality.

Medium-strong alllele; suppresses of ced-9(n1950 n2162) maternal effect lethality. Reference: (1999) Genetics 153(4):1655-71.

Suppressor of ced-9(n1950n2161) maternal effect lethality. Strong allele of ced-3.

Suppressor of ced-9(n1950n2161) maternal effect lethality.

n2454 is a strong allele of ced-3.

Animals are Egl and show sluggish locomotion and foraging behavior. Null allele: egl-10 is deleted or severely rearranged, and EGL-10 protein is undetected by Western blotting and in situ staining of animals.

Weak allele of mek-2. 95% of the animals are WT. See also WBPaper00002150.

Heterozygotes are WT and segregate WT, Sterile Vuls and scrawny Dpys. n2678 is a suppressor of let-60(n1046) Muv. n2678 animals are Vul and recessive sterile. n2678 is a strong allele, probably null. See also WBPaper00002150.

Suppressor of let-60(n1046). Strongest allele. Homozygous viable.

Suppressor of n1046. Weak allele of ksr-1.

Suppressor of n1046. Strong allele.

n2449 is a weak allele of ced-3.

n2424 is a weak allele of ced-3.

n1434 restores death of NSM and I2 sister. n703sd: multiple (3-4) NSMs.

n3082 is a semidominant suppressor of egl-1(n1084sd) Egl- phenotype. Recessive Ced- phenotype - average of 11 extra cells in anterior pharynx. n3082 is a loss of function allele.

n1812: dead cells persist, maternal rescue of embryonic.

Unengulfed cell corpses. Strong allele of ced-7.

Segregates Unc-86 animals and dead eggs.

Dominant suppressor of unc-93(e1500), recessive small scrawny slow growing phenotype.

nIs93 [(pJHT27)lin-36p::GFP::lin-36 (full-length coding) + rol-6(su1006)]. Rollers. Non-Muv -- nearly completely penetrant rescue of Lin-36. Reference: Thomas & Horvitz (1999) Development 126(15):3449-59.

Heterozygotes are WT and segregate WT, Sterile Dpys, and Mel Uncs. cup-5(n3194) is a Q139 ochre allele with a maternal effect lethal phenotype including accumulation of refractile bodies resembling apoptotic cells in some regards. cup-5 homozygotes are also defective in coelomocyte uptake.

Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested nT1[qIs51] aneuploids, and non-GFP tm2217 homozygotes (arrested L1 larvae). Homozygous nT1[qIs51] inviable. Pick WT GFP and check for correct segregation of progeny to maintain.

Heterozygotes are WT and GFP+. Pick GFP+ to maintain -- viable pf88 homozygotes (Pvl Egl) can overtake the balanced population. nT1[qIs51] is homozygous lethal. qIs51 is an insertion of ccEx9747 with markers: myo-2::GFP expressed in the pharynx throughout development, pes-10::GFP expressed in the embryo, and a gut promoter F22B7.9::GFP expressed in the intestine. Reference: Verghese E, et al. Dev Biol. 2011 Aug 15;356(2):516-28.

Homozygous viable with no obvious morphological, locomotory, or behavioral phenotypes. However, these animals display cilia-related chemosensory (Che) defective and dye-fill (Dyf) defective phenotypes. 2009 bp deletion with flanking sequences of GATAAGAGGAAATCTTTTTGGAGAGTTGGA and ATTTAGTTTTTCACAAAGAACACCGCAATA.