Search Strains

Recessive. Maternal rescue Dpy. Slightly Unc. Small broods. CAN migration nearly normal in absence of kyIs5.

Unc. Recessive. CAN migration nearly normal in absence of kyIs5.

Weak loopy Unc. CAN migration mostly normal in absence of kyIs5 reporter.

Animals with sDp2 are WT. Animals without the duplication are severe Uncs with withered tails, are small and often have lateral ectopic vulvae. gm123 does not survive through more than 1-2 generations. Many cell migrations defects in gm123 animals.

Unc. Recessive allele for most phenotypes. Appears to be a gain of function mutation (see Zipkin et al. 1997).

Withered tail. Unc. Small broods. Recessive. Hypomorphic allele of vab-8.

kyIs5 [ceh-23p::unc-76::GFP + lin-15(+)] IV. kyIs5 contains a fragment of unc-76 protein that drives enrichment of GFP in the axons.

Heterozygotes are WT and segregate WT, Dpy Steriles and dead eggs. Derived from strain TY1353. Grows fairly slowly but seems more stable than TY1353, which gives lots of steriles.

mIs14 [myo-2p::GFP + pes-10p::GFP]. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and non-GFP or302 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain. or302 homozygotes are GFP- and are Emb, ABar and have EMS spindle misalignment. or302 is a deletion starting at 503 and ending at 1578 of C27A2.6.

Heterozygotes are WT and segregate WT, Sterile Dpys and Clear lethals (die as L1-L2s). Differentiation of AIY, CAN defective.

Vulvaless. About 91% of the animals die as L1 or early L2. n1619 suppresses clr-1.

ay75gf: ts dominant Clr, Sterile; Dominant sterile at 25C, fertile at 15C, severely reduced fertility at 20C. At 15C, ay75gf: recessive adults Clr, partially penetrant Muv. At 15C, heterozygotes segregate 50% WT, 25% Dpy, and 25% adult Clear.

Heterozygotes are WT and segregate WT, Lon Males, early L1 larval arrested animals (n1456 homozygotes) and dead eggs. n1456 is an early nonsense mutation in the extracellular domain of EGL-15/FGFR (Q268 STOP).

No obvious phenotype. The primers used to isolate (ok198)were: LS969.E1: TGAGCTCGGAGATGTTGCT; LS969.E2: CCGGTCATTCCTCATTCACT; LS969.I1: GGGAGGGTCTTACGTTGTGA; LS969.I2: GTCGAAAAATCAACTTGCGG; The deletion band runs at about 2000bp. The wt band (based on the inside primers) is 3195bp making the deletion about 1200bp of the gene F54A5.3.

Do not keep below 20C. Male-Female strain. Reference isolate for Caenorhabditis sp. 43 genome sequence. Inbred derivative of NIC1070 (25 generations of inbreeding).

Do not keep below 20°C.  Male-female.  Caenorhabditis sp. 39 wild isolate. Gonochoristic species; isofemale line. Isolated from rotting Clusia fruits on the island of Dominica (2014). Previously known as Caenorhabditis sp. 39.

Unreflexed gonad. Previously known as mig-8.

Daf-constitutive allele rh62 forms partial-dauer larvae under replete conditions at all temperatures.

Delayed gonadal and extragonadal development. Hermaphrodites (n=100), 74%

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Unc. Loss-of-function or null allele.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Excretory canal defect. Large fluid-filled cysts appear randomly along the excretory canal, especially at the tips: 100% penetrant. Cysts often visible as clear spots by low-power microscopy. Shortened canals. Smaller cysts in amphid sheath. Stop mutation in 2nd Ras-like IRGP domain. Encodes homologue of human IRGC. [NOTE (08/2025): The correct genotype of this strain is exc-1(rh26), not exc-3(rh26) as previously described.]

WT strain which throws WT and dead eggs. Sick and slow growing!!!

Delayed hatching from egg shell. QL and descendant cells migrate forward instead of backward (incomplete penetrance). QR and descendant cells migrate backward instead of forward (weak penetrance). Semidominant with respect to cell migration.

Excretory canal defect. Canal is invariably short with multiple cysts of varying size clustered along length, especially at the tips. Visible only by Nomarski microscopy. Tail spike is often slightly malformed. Animal is somewhat pale.

Poorly growing strain; most homozygotes fail to reach adulthood, and those that do are Egl. klf-3 was formerly known as mua-1.

Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).

Abnormal body shape. Unc. Severity of phenotype: rh326 > rh80 > rh148.

Bacteria. NJF01 originates from E. coli ET505 (F-, lambda- lysA0::Tn10 IN(rrnD-rrnE)1), modified with DE3 and (delta)rnc-38. The E. coli is lysine auxotroph and resistant to kanamycin and tetracycline. IPTG induces expression of the T7 polymerase. Grow at 37 °C on LA plates or in LB liquid medium. Reference: Fredens J, et al. Nat Methods. 2011 Aug 28;8(10):845-7.

Isoform-specific activation of SKN-1C. Heterozygotes are GFP+ and non-Unc. Segregates GFP+ non-Unc (heterozygotes), GFP+ Unc (tmC25 homozygotes), and GFP- non-Unc (skn-1 homozygotes). Eggs produced by skn-1(nic952) homozygotes do not hatch. Maintain by picking GFP+ non-Unc heterozygotes and checking for correct segregation of progeny. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

nicTi600 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi556]] I. Maintain at 20C, somewhat sick at 25C. Unc. nicTi600 is a modified version of oxTi556 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi601 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi726]] II. Maintain at 20C, somewhat sick at 25C. Unc. nicTi601 is a modified version of oxTi726 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi602 [eft-3p::tdTomato::H2B::unc-119(-)[*oxTi392]] V. Maintain at 20C, somewhat sick at 25C. Unc. nicTi602 is a modified version of oxTi392 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi603 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi705]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTi603 is a modified version of oxTi705 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi604[eft-3p::tdTomato::H2B::unc-119(-) [*oxTi400]] X. Maintain at 20C, somewhat sick at 25C. Unc. nicTi604 is a modified version of oxTi400 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicIs77 [gst-4p::mCherry] V. Expression of gst-4p::mcherry reporter is strongly induced by oxidative stress. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

nicTi605 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi612]] III. Broad, nuclear red fluorescence. Unc. Maintain at 20C, somewhat sick at 25C. Unc. nicTi605 is a modified version of oxTi612 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicTi606 [eft-3p::tdTomato::H2B::unc-119(-) [*oxTi391]] IV. Maintain at 20C, somewhat sick at 25C. Unc. nicTiX606 is a modified version of oxTi391 that does not rescue unc-119(ed3). Broad, nuclear red fluorescence. This strain can be used for integration of multicopy transgenes using Fluorescent Landmark Interference (FLInt) and unc-119 rescue. Reference: Yanagi KS & Lehrbach N. MicroPublication Biology. 2024 (submitted).

nicIs146 [skn-1Ap::mCherry::H2B] II. Fluorescent reporter for transcription of skn-1A. Nuclear-localized mCherry expression in most cells. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

nicIs148 [skn-1Cp::mCherry::H2B] II. Fluorescent reporter for transcription of skn-1C. Nuclear-localized mCherry expression in most cells. Reference: Jochim B, et al. PLoS Genet. 2025 Jul 7;21(7):e1011780. doi: 10.1371/journal.pgen.1011780. PMID: 40623109.

qyIs127 [lam-1p::lam-1::mCherry + unc-119(+)] V. qyIs166 [cdh-3p::GFP::CAAX + unc-119(+)] X. Temperature-sensitive sterile; maintain at 20C or lower for optimum fertility. Increased sensitivity to RNAi when compared to wild-type animals. lam-1p::lam-1::mCherry expression can be weak and variable. Reference: Kelley, LC, et al. Developmental Cell. 2019 Feb 11;48(3):313-328.e8.

qyIs366 [ser-2(prom3)::hpo-30::GFP + unc-119(+)] V. Reporter allows visualization of HPO-30 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

qyIs368 [ser-2(prom3)::dma-1::GFP + unc-119(+)] I. Reporter allows visualization of DMA-1 trans-membrane protein in PVD dendrites. Reference: Zou W, et al. PLoS Genet. 2015 Sep 22;11(9):e1005484. PMID: 26394140.

GFP tag inserted into the C-terminus of the endogenous dlg-1 locus.

cpIs121 [lag-2p::mNG::PH::F2A::rde-1] I. Temperature-sensitive: maintain at 16-20C. RNAi-response variant. RNAi-hypersensitized DTC-specific RNAi strain that labels all rde-1(+) cells with mNeonGreen. Reference: Linden LM, et al. Dev Biol. 2017 Sep 1;429(1):271-284.

CRISPR/Cas9-engineered insertion of GFP::3xflag::AID* tags into endogenous unc-59/septin locus. Reference: Chen D et al. MicroPubl Biol. 2019 Dec 20;2019:10.17912/micropub.biology.000200. doi: 10.17912/micropub.biology.000200. PMID: 32550451.

Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing.