| DW104 |
C. elegans |
brc-2(tm1086) III/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
tm1086 is homozygous lethal. Maternally rescued. Fails to produce viable progeny due to a defect in repairing meiotic DNA double-strand breaks. Chromosomes are visibly aggregated at diakinesis. Maintain by picking GFP progeny and checking that the non-GFP progeny that are produced fail to give viable progeny. qIs48 is an insertion of ccEx9747 with markers: myo-2::GFP expressed brightly in the pharynx throughout development, pes-10::GFP expressed in embryos, and a gut promoter driving GFP in the intestine, and is homozygous lethal.
|
|
| DWF1105 |
Acrobeloides sp. |
Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger.
|
|
| DWF1106 |
Acrobeloides sp. |
Show Description
Isolated in Arizona desert. Identification by E. Mae Noffsinger as Acrobeloides obliquus.
|
|
| DWF1108 |
Acrobeloides sp. |
Show Description
Originally from ecological study at University of GA. Identification by E. Mae Noffsinger.
|
|
| DWF1301 |
Cephalobus sp. |
Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
|
|
| DWF1501 |
Dolichorhabditis sp. |
Show Description
Isolated in Brazil.
|
|
| DWF1604 |
Operculrhabditis sp. |
Show Description
Originally from UCR collection. Identification by E. Mae Noffsinger.
|
|
| DWF1701 |
Zeldia sp. |
Show Description
Isolated in Fort Collins, CO. Species identification done by Lynn Carta.
|
|
| DWP219 |
C. elegans |
daam-1(ups39) V. Show Description
Superficially wild-type. ups39 is a CRISPR-engineered deletion within daam-1. daam-1(ups39) encodes an in-frame stop codon near the start of its FH2-coding sequence, and a 1-nt frame shift due to the LoxP site, and is thus predicted encode a non-functional formin. Reference: Sundaramurthy S, et al. Cytoskeleton (Hoboken). 2020 Oct;77(10):422-441. doi: 10.1002/cm.21639. PMID: 33103378.
|
|
| DWP294 |
C. elegans |
rhIs2. Show Description
rhIs2 [pat-3::HA::GFP]. rhIs2 contains cosmid-derived full-length pat-3, including 5 kb 5UTR and 1 kb 3 UTR, with HA and GFP(S65C) tags inserted prior to the pat-3 stop codon. Reference: Plenefisch JD, et al. Development. 2000 127(6):1197-207. doi: 10.1242/dev.127.6.1197.
|
|
| DWP3 |
C. elegans |
qaIs8001. Show Description
qaIs8001 [fhod-1::GFP + unc-119(+)]. Integrated functional translational FHOD-1::GFP fusion. Superficially wild-type. Reference: Mi-Mi L, et al. J Cell Biol. 2012 Jul 9;198(1):87-102. doi: 10.1083/jcb.201202053.
|
|
| DY164 |
C. elegans |
unc-32(e189) syIs80 III; him-8(e1489) IV. Show Description
syIs80 [(pPGF11.13) lin-11::GFP + unc-119(+)] III. Animals are Unc. GFP fluorescence is observed in vulval cells, uterine pi cells and VC neurons.
|
|
| DZ205 |
C. elegans |
dsh-2(ez25)/mIn1 [mIs14 dpy-10(e128)] II; him-8(e1489) IV. Show Description
mIs14 [myo-2p::GFP + pes-10p::GFP]. Him. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP+ heterozygotes, Dpy bright GFP+ (mIn1 homozygotes), and Egl non-GFP ez25 homozygotes. Pick WT dim GFP and check for correct segregation of progeny to maintain.
|
|
| DZ224 |
C. elegans |
him-8(e1489) IV; ezIs1 X. Show Description
ezIs1[K09C8.2::GFP + rol-6(su1006)]. ezIs1 was integrated with pPD95.65(K09C8.2 promoter and unc-54 3') and pRF4. Worms are 100% Rollers. GFP is expressed in male seminal vesicle and vas deferens cells. No expression in the hermaphrodite gonad is observed.
|
|
| DZ240 |
C. elegans |
fkh-6(ez16)/mIn1 [dpy-10(e128) mIs14] II; him-8(e1489) IV. Show Description
Heterozygotes are WT and GFP+ in the pharynx. mIn1[dpy-10(e128) mIs14] homozygotes are Dpy and GFP+ in the pharynx. Homozygous fkh-6(ez16) hermaphrodites are sterile and have gonadogenesis defects. Homozygous fkh-6(ez16) males are sterile and strong Gon, "white patch" phenotype. 25% of males have a hermaphrodite vulval structure.
|
|
| DZ325 |
C. elegans |
ezIs2 III; him-8(e1489) IV. Show Description
ezIs2 [fkh-6::GFP + unc-119(+)]. ezIs2 was integrated with pPD95.69 (fkh-6 promoter and unc-54 3') and pMM106b (unc-119(+)). Worms are 100% non-Unc (the unc-119 background has been crossed out). GFP expression in adult hermaphrodite spermatheca is bright and weak staining is also observed in the proximal sheath cells. Weak GFP staining is also observed in Z1/Z4 cells in both sexes.
|
|
| DZ390 |
C. elegans |
ezIs10 II; unc-119(ed3) III; him-8(e1489) IV. Show Description
ezIs10 [(pWY3) lin-32::GFP + unc-119(+)].
|
|
| DZ683 |
C. elegans |
tra-2(ar221) II; xol-1(y9) X; rdIs4. Show Description
rdIs4 [ehn-3a::Venus(delta)]. Temperature-sensitive. Must be maintained at 15°C to produce progeny. Strain develops as hermaphrodites at 15°C (some animals are intersex with male tails), and develops as XX pseudomales at 25°C. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.
|
|
| DZ685 |
C. elegans |
xol-1(y9) X; rdIs4. Show Description
rdIs4 [ehn-3a::Venus(delta)]. Slightly Egl. Male lethal. GFP expressed in gonadal precursors. Reference: Kroetz MB & Zarkower D. G3 (Bethesda). 2015 Oct 23;5(12):2831-41.
|
|
| DZ840 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III.
|
|
| DZ841 |
C. elegans |
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III; zuIs236. Show Description
tra-1(ez72[biotag::GFP::TEV::3xflag::tra-1]) III. zuIs236 [his-72(1 kb 5'UTR)::BIRA::GFP::his-72(1 kb 3'UTR) + unc-119(+)]. Location of zuIs236 is not known, but is not in LG III.
|
|
| EAG16 |
C. elegans |
eagIs6[*fxIs10] II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAG25 |
C. elegans |
eagIs6[*fxIs10] ujIs113 II. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ujIs113 [pie-1p::mCherry::H2B::pie-1 3'UTR + nhr-2p::his-24::mCherry::let-858 3'UTR + unc-119(+)]. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. H2::mCherry marks germline nuclei. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAG28 |
C. elegans |
eagIs6[*fxIs10] II; ltIs44 IV. Show Description
eagIs6 [spn-4p::jGCaMP7s::pie-1 3'UTR + HygR [*fxIs10] ] II. ltIs44 [pie-1p::mCherry::PH(PLC1delta1) + unc-119(+)] IV. CaFE reporter (calcium inducible fluorescence in germline). Calcium-inducible fluorescent jGCaMP7s protein codon-optimized for elegans and expressed in germline enables visualization of calcium wave upon fertilization. mCherry::PH marks cell membranes. Reference: Toperzer KM, et al. Biol Open. 2023 Sep 15;12(9):bio059832. PMID: 37602653.
|
|
| EAK102 |
C. elegans |
eeeIs1. Show Description
eeeIs1 [unc-54p::Htt513(Q15)::YFP::unc-45 3'UTR]. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EAK103 |
C. elegans |
eeeIs2. Show Description
eeeIs2 [unc-54p::Htt513(Q128)::YFP::unc-45 3'UTR]. Motility defect. YFP expression in body wall muscle cells. YFP is fused to a fragment of mutant human Huntingtin protein. Reference: Lee AL. et al. PLoS One. 2017 Mar 10;12(3):e0173644. [NOTE: The transgene in this strain was previously described as using the unc-45 promoter, but it is actually the unc-54 promoter.]
|
|
| EB4491 |
C. elegans |
dzDf1 lem-4(ve691[myo-2p::GFP])/tmC25 [unc-5(tm9708)] IV. Show Description
dzDf1 [IV:506328 - 698511 deleted]. Pick wild-type GFP+ to maintain. Heterozygotes are wildtype GFP+ and segregate into dead eggs (dzDf1 homozygotes), wild-type GFP+ (Heterozygotes), and Unc (tmC25 homozygotes).
|
|
| EB4499 |
C. elegans |
dzDf2/szT1 [lon-2(e678) umnIs17] I; +/szT1 X. Show Description
dzDf2 [I:2037935 - 2261431 deleted]. Pick wild-type GFP+ to maintain. Heterozygotes are wildtype GFP+, segregate into wild-type GFP+, dead eggs, and GFP+ Lon males.
|
|
| EB4500 |
C. elegans |
dzDf3/szT1 [lon-2(e678) umnIs17] I; +/szT1 X. Show Description
dzDf3 [I:1999831 - 2100118 deleted]. Heterozygotes are wild-type GFP+. Segregate wild-type GFP+, dead eggs, and GFP+ Lon males.
|
|
| EC100 |
C. elegans |
eeEx100. Show Description
eeEx100 [his-24::GFP + rol-6(su1006)]. Rollers. Nuclear GFP fluorescence detected beginning with the eight-cell stage of the embryo in all somatic nuclei without the P-cell. In adults the GFP signal in somatic cells and in few hermaphrodites in undifferentiated germ nuclei and in oocytes and sperm. About 20% transmission.
|
|
| EC106 |
C. elegans |
eeEx106. Show Description
eeEx106 [hil-1::GFP + rol-6(su1006)]. GFP expression in body wall muscles, in the vulva sex muscles, in the marginal cells of the pharynx, in a limited number of head neurons, in the cytoplasm of excretory cells. The expression starts in the about 100-cell embryo in a few cells in the periphery in the nucleoplasm and in the nucleoli. Complex extrachromosomal arrary....pick Rollers. About 20% Rollers.
|
|
| ED3083 |
C. briggsae |
C. briggsae wild isolate. Show Description
Caenorhabditis briggsae wild isolate. Isolated from compost from Jenny Pettifor's garden in the Paview neighborhood in Johannesburg, South Africa, on May 5, 2006. Landscape: Urban_garden. Isolated from a compost sample from a private garden in Johannesburg, South Africa, March-April 06 by E. Dolgin. Same compost sample as ED3078-3089. WBPaper00035666. GPS: -26.200001 28.000000, Johannesburg, South Africa. Substrate: compost_heap. Sampled_by: Elie Dolgin WBPerson12345. 2006. For whole-genome sequence-verified wild strains, please request from the Caenorhabditis Natural Diversity Resource (www.caendr.org).
|
|
| EE31 |
C. elegans |
mup-2(e2346) unc-6(e78)/lon-2(e678) X. Show Description
Heterozygotes are WT and segregate WT, Lon and Uncs. If raised at 25C, the Uncs are Mup -> 3-fold/L1 arrest. If raised at 15C the Uncs are fertile (reduced brood).
|
|
| EE66 |
C. elegans |
mup-2(e2346) unc-6(e78) X. Show Description
Temperature sensitive. Maintain at 15C. At 25C the animals will arrest at 3-fold/L1 stage. Unc.
|
|
| EE67 |
C. elegans |
him-8(e1489) IV; mup-2(e2346) X. Show Description
Temperature sensitive. At 15C the animals are essentially WT, but with a reduced brood; males mate well. Embryos raised at 25C will result in 3-fold/L1 arrest (Mup). Larval shift to 25C will result in sterile hermaphrodites but males that are fertile.
|
|
| EE86 |
C. elegans |
mup-4(mg36) III; upIs1. Show Description
upIs1 [mup-4::GFP + rol-6(su1006)]. Rollers. [NOTE: 11/2006: Pamela Hoppe determined that the strain is homozygous for mup-4.]
|
|
| EEG107 |
C.elegans |
tph-1(mg280) II; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. When tph-1 mutants carrying mudIs1 are exposed to blue light, the worms continue to move rather than stopping like wild-type animals. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG108 |
C. elegans |
mod-5(n822) I; mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EEG98 |
C. elegans |
mudIs1. Show Description
mudIs1 [tph-1p::ChR2::GFP + myo-3p::mCherry]. Worms stop moving when exposed to blue light. Reference: Pokala N & Glater EE. 2018. Journal of Undergraduate Neuroscience Education. 162(2): A152-A158.
|
|
| EG1020 |
C. elegans |
bli-6(sc16) IV; dpy-11(e224) V; lon-2(e678) X. Show Description
Dpy suppresses Bli and Lon. Strain appears to be only slightly Dpy. Useful for mapping, especially Unc mutations. Separately, dpy-11 causes dumpiness, bli-6 adult worms develop blisters on their bodies, and lon-2 worms are about 150% WT length.
|
|
| EG1285 |
C. elegans |
lin-15B&lin-15A(n765) oxIs12 X. Show Description
oxIs12 [unc-47p::GFP + lin-15(+)]. Integration maps at +2.0 on X. Expression of GFP in all GABAergic neurons.
|
|
| EG144 |
C. elegans |
inx-16(ox144) I. Show Description
Pax, Dec-slow (34" defecation cycle). Maintain uder normal conditions. Reference: Peters MA, et al. Curr Biol. 2007 Sep 18;17(18):1601-8.
|
|
| EG1470 |
C. elegans |
oxEx229. Show Description
oxEx229 [Mos1 Substrate + myo-2::GFP]. Should be grown at 25C.
|
|
| EG1642 |
C. elegans |
lin-15B&lin-15A(n765) X; oxEx166. Show Description
oxEx166 [HSP::MosTRANSPOSASE + CC::GFP + lin-15(+)]. Should be grown at 25C. Maintain by picking non-Muv. Animals carrying the array should be GFP+.
|
|
| EG1653 |
C. elegans |
oxIs22 II. Show Description
oxIs22 [unc-49p::unc-49::GFP + lin-15(+)]. Psoralen integration of oxEx129 [unc-49Bp(long)::GFP + lin-15(+)]. Dorsal and ventral.
|
|
| EG2288 |
C. elegans |
lin-15B&lin-15A(n765) X; oxEx110. Show Description
oxEx110 [unc-49c::GFP + lin-15(+)]. Maintain by picking non-Muv.
|
|
| EG2537 |
C. elegans |
oxEx344. Show Description
oxEx344 [MosPolyA substrate + myo-2::GFP]. Should be grown at 25C.
|
|
| EG2710 |
C. elegans |
unc-57(ok310) I. Show Description
T04D1.3 Homozygous. Outer left primer sequence: GCGAATCAATACCTTTCGGA. Inner left primer sequence: GCTACTCGAGCAAAAATGGC. Outer right primer sequence: CCTGGTGGAGGTCCTTGATA. Inner right primer sequence: TCAAGGGTATCGCTTTTTCG. Deletion length: 1959 bp. Deletion breakpoints: AAGCTGTCAAAGTTTAATTTTTTTTTAATCTGCTGAAATTTTTTTCCACTTCCCCTTTT AGATATAATCACAAAAAAATTCTTTT[left break]....deletion....[right break]GAATTTTTTAAATCAATTTTCTAAATCGAAACTATTCGTTTTTCAATTTTTAT TTTAAAAAATCGAAAAAGCGATACCCTTGATTA. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu
|
|
| EG276 |
C. elegans |
exp-1(ox276) II. Show Description
Maintain under normal conditions. Reference: Beg AA & Jorgensen EM, Nat Neurosci. 2003 Nov;6(11):1145-52.
|
|
| EG2762 |
C. elegans |
oxEx166. Show Description
oxEx166 [HSP::MosTransposase + coelomocyte::GFP + lin-15(+)]. Should be grown at 25C.
|
|