| RG3191 |
C. elegans |
lem-4(ve691[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25 [unc-5(tm9708)] IV. Show Description
Homozygous sterile, Pvl. Deletion of 5370 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve691 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: tctcttttcagctggaaactgtaaactcct ; Right flanking sequence: TGGGCGATTTTAGCATATCTTCCATGGAAT. sgRNA #1: ttatttaacttcctatctca; sgRNA #2: aactcacTTATACAAGTCTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|