Search Strains

zcIs14 [myo-3::GFP(mit)]. Stable transgenic line expressing GFP at high levels in mitochondria of body wall muscle. Slight developmental delay and reduced brood size observed.

foxSi27 [pie-1p::tomm-20(gDNA)::mKate2::HA::tbb-2 3'UTR ] I. Single-copy MosSCI insertion into oxti185. Germline-specific expression of TOMM-20::mKate2::HA can be used for fluorescent identification of germline mitochondrial morphology and tissue-specific isolation of mitochondria. Reference: Ahier A, et al. Nature Cell Biol. 2018 Mar;20(3):352-360. doi: 10.1038/s41556-017-0023-x. PMID: 29358705.

foxSi37 [ges-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Gut-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi39 [gcy-6p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. ASE-specific expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi41 [dpy-7p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Hypodermal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi44 [rgef-1p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Neuronal expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi75 [eft-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Ubiquitous expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

foxSi16 [myo-3p::tomm-20::mKate2::HA::tbb-2 3' UTR] I. Transgene inserted into oxTi185. Superficially wild-type. Muscular expression of reporter construct. This strain is part of toolkit to affinity purify mitochondria from specific tissues. Reference: Ahier A, et al. Nat Cell Biol. 2018 Mar;20(3):352-360.

Prolonged lethargus sleep duration. rem5 is an early stop mutation, likely null. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.

Prolonged lethargus duration. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.

Most defects are similar to bar-1(ga80) single mutant animals [bar-1(ga80) hermaphrodites are usually Egl and often have a protruding vulva (Pvl), although approx. 40% of animals appear WT on plates. Also slightly Unc. In bar-1(ga80) hermaphrodites any of the six vulval precursor cells (P3.p - P8.p) can sometimes fuse with hyp7 without dividing, and P5.p - P7.p can adopt the tertiary cell fate instead of the primary or secondary fates. In addition, the neuroblast QL and its progeny migrate towards the anterior instead of the posterior, and the cell P12 usually adopts the fate of P11. bar-1(ga80) do mate, but poorly. bar-1 encodes a beta-catenin molecule and the ga80 mutation is predicted to cause an early truncation of the protein.] Increased severity of ray 1 displacement.

Dies at 15-20C with mostly dead embyros and a few dead larvae. Grows best at 24C. Survives at 25C, but worms look sick (often small and clear) and have very reduced brood sizes. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]

NeuroPAL landmark reporter in a sextuple CUT mutant background. See description of strain OH15262 for full description of otIs669 NeuroPAL (Neuronal Polychromatic Atlas of Landmarks) transgene (Yemini E, et al. Cell. 2021 Jan 7;184(1):272-288.e11. PMID: 33378642). otDf1 is a deletion affecting ceh-41, ceh-21, T26C11.9, and ceh-39. Reporter expression is affected in this mutant, suggesting alterations in neuronal identity.

Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.

Non-Unc at all temperatures. See also WBPaper00004764.

Non-Unc at all temperatures.

Temperature sensitive mec-8 allele, mechanosensory abnormal at 25 C. Reference: Spike CA, et al. Mol Cell Biol. 2001 Aug;21(15):4985-95.

mnIs35 [smu-2::GFP + unc-36(+)]. Superficially wild-type. Although unlikely, unc-36 might still be present in the background. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

mnEx142 [smu-2::GFP + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

WT PHENOTYPE. This strain should throw dead eggs, but it is not doing so. Hasn't been checked to see if the deficiency is still there.

mnEx151 [smu-1::GFP + smu-2::3xHA + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

mnIs66 [smu-2::HA + unc-36(+)]. Strain should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.

mnEx171 [dyf-6::GFP + rol-6(su1006)]. Reference: Bell LR, et al. Genetics 2006 173: 1275-1286.

LETHAL EMBRYONIC NULL ALLELE Maintain by picking WT. See also CGC 1806.

Hets are WT and segregate WT, dead eggs and DpyUnc. Maintain by picking WT. [2/97: This strain also throws Dpys. RK Herman put a new mnC1 dpy-10 unc-52 chromosome into the strains, and it still continues to throw Dpys. It seems that the mnC1 dpy-10 unc-52 chromosome is correct. It's possible that the mnDf97 chromosome is broken.]

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

dvIs19 [(pAF15) gst-4p::GFP::NLS] III. Oxidative stress-inducible GFP. Sma. Dominant allele of skn-1 is constitutively active and does not respond to dietary restriction. Reference: Paek J, et al. Cell Metab. 2012 Oct 3;16(4):526-37.

Temperature-sensitive. Maintain at 15C. The embryos from homozygous mutant mothers display defects in the unequal cell divisions of P2 and P3, defects in partitioning of germ granules during these divisions, and defects in formation of the germ-line precursor cell P4. The embryos that lack P4 develop into sterile adults. These defects are incompletely expressed and sensitive to temperature. Homozygous mothers produce about 10% sterile progeny at 16C and 70% sterile progeny at 25C. The temperature-sensitive period is early in embryogenesis, from fertilization to about the 28-cell stage. See also WBPaper00002282.

Heterozygotes are WT and segregate WT, DpyUnc and Uncs which give sterile progeny (maternal effect sterile: the progeny from mutant mothers are sterile). The mutation is a strict mel, fully penetrant, and fully expressed. Sterility is due to a failure in germ-cell proliferation.

Fertile at all temperatures.

Dpy. Fertile at all temperatures.

Throws males. Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.

Throws males. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.

Temperature sensitive sterility. Should be cultured at 15C or 20C. At 25C, spermatocytes fail in cytokinesis and accumulate as multinucleate cells unable to mature to spermatids. Milder defect in oogenesis is not temperature sensitive. Oocyte production is slowed, but appear relatively normal and are fertile. Inefficient translation of several maternal mRNAs (mex-1, oma-1, pos-1, and pal-1). Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 1, germ cell specific, P granule associated; F53A2.6). Homozygous 590 bp deletion starts at nt 191 in exon 1 and extends through exon 2 and into the 3' UTR to nt 780. The deletion removes over 70% of the coding region for IFE-1, including the helices and sheets that make up the mRNA platform and a Trp residue essential for m7GTP cap binding, suggesting it is a null mutation. Deletion breakpoint determined by sequencing by SS is: aagtggcctcaacgcgttgt//tgatgaaaattaattgtatt. The ife-1 gene is the third in an operon, but the deletion is contained completely within the ife-1 gene.

Fertile at all temperatures.

Dpy. Fertile at all temperatures.

Dpy. Unc. Mostly sterile at all temperatures, but a small fraction are fertile at low temperatures. Maintain at 15C.

Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP iow1 homozygotes (viable; see note below). Homozygous nT1[qIs51] inviable. Pick wild-type GFP and check for correct segregation of progeny to maintain. iow1 is a separation-of-function allele of mre-11. Homozygotes develop into adults wild-type in appearance, but laying dead eggs due to defects in meiotic DSB repair: mre-11(iow1) worms form meiotic DSBs but are impaired in their resection. Pick GFP+ to maintain (mre-11(iow1)/nT1[qIs51]) and GFP- to obtain homozygous mre-11(iow1) worms for analysis. Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47. doi: 10.1128/MCB.00055-13. Epub 2013 May 13. Erratum in: Mol Cell Biol. 2015 Jul;35(14):2568. PubMed PMID: 23671188; PubMed Central PMCID: PMC3700128.

Homozygous gfp and 3xflag C’ terminal tag inserting just before the STOP codon of mre-11. The strain is fertile and contains wild type germline (examined by DAPI). GFP is expressed in all germline nuclei. Maintain the strain by picking worms at 20C, no selection required. gfp::3xflag was added by CRISPR/Cas9 using pDD282-based vector. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

Heterozygotes are wild-type with pharyngeal-expressed GFP, and segregate wild-type GFP+(pharynx) heterozygotes, arrested nT1[qIs51] homozygotes, and viable non-GFP(pharynx) ubc-9(iow97[3xFLAG::ubc-9]) homozygotes. Maintain the strain by picking wild-type GFP+ worms and checking for correct segregation of progeny. iow97 was created by CRISPR/Cas9 insertion of a 3xflag tag at the N-terminus of the endogenous ubc-9 locus; however, the tagged protein is not fully functional. SSM491 is a replacement for SSM291: analysis shows that in all parameters tested, SSM491 is identical to SSM291, which was genetically unstable and prone to breaking down. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.

Reference: Yin Y & Smolikove S. Mol Cell Biol. 2013 Jul;33(14):2732-47.

Null allele. ins-7(ssr1532) is a CRISPR-engineered deletion that removes the second exon of ins-7 and introduces stop codons. Reference: Liu CC, et al. Nat Commun. 2024 Aug 11;15(1):6869. doi: 10.1038/s41467-024-51077-3. PMID: 39127676.

ssrIs496 [atgl-1p::GFP + rol-6(su1006)]. Rollers. Transcriptional atgl-1::GFP reporter. Reference: Noble T, et al. Cell Metab. 2013 Nov 5;18(5):672-84. doi: 10.1016/j.cmet.2013.09.007. PMID: 24120942.

Heterozygotes are WT and segregate WT, Dpy Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment. Not well balanced. klf-3 was formerly known as mua-1.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.

ncIs2 [pH20::GFP + pBlueScript]. Heterozygotes are WT and segregate WT, Uncs, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced. Neurons visualized with ncIs2.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

Heterozygotes are WT and segregate WT, BliEglUnc, and animals with muscle attachment defects and ventral cord displacement and detachment which arrest in larval development. Not well balanced.

ncIs2 [pH20::GFP + pBlueScript]. Expresses GFP in nearly all neurons. No morphological or behavioral phenotypes.