Search Strains

More Fields
Strain Species Genotype Add
TH229 C. elegans unc-119(ed3) III; ddIs68. Show Description
ddIs68 [bub-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH234 C. elegans unc-119(ed3) III; ddIs145. Show Description
ddIs145 [klp-7::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH237 C. elegans unc-119(ed3) III; ddEx291. Show Description
ddEx291 [his-24::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Pick non-Unc to maintain. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH238 C. elegans unc-119(ed3) III; ddIs151. Show Description
ddIs151 [mdf-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH243 C. elegans unc-119(ed3) III; ddIs153. Show Description
ddIs153 [knl-1::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH246 C. elegans unc-119(ed3) III; ddIs159. Show Description
ddIs159 [arx-2::TY1::EGFP::3xFLAG(92C12) + Cbr-unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH322 C. elegans unc-13(e51) rsa-1(dd10) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.
TH323 C. elegans unc-13(e51) rsa-1(dd13) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Maternal effect lethal (Mel) allele balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP bn115 homozygotes (sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Reference: Schlaitz et al., (2007) Cell 128:115-27.
TH346 C. elegans unc-119(ed3)III; ddIs193. Show Description
ddIs193 [rabs-5::2xTY1::GFP:: FRT::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH439 C. elegans unc-119(ed3)III; ddIs254. Show Description
ddIs254 [ctbp-1::2xTY1::GFP:: FRT::3xFLAG + unc-119(+)]. Pick non-Unc to maintain. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH458 C. elegans unc-119(ed3) III; ddIs262. Show Description
ddIs262 [mes-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH463 C. elegans unc-119(ed3) III; ddIs263. Show Description
ddIs263 [eat-4::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH482 C. elegans unc-119(ed3) III; ddEx69. Show Description
ddEx69 [brd-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. Maintain by picking wild-type (non-Unc) animals. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH486 C. elegans unc-119(ed3) III; ddIs268. Show Description
ddIs268 [rad-51::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH502 C. elegans unc-119(ed3) III; ddIs290. Show Description
ddIs290 [sax-7::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TH509 C. elegans unc-119(ed3) III; ddIs297. Show Description
ddIs297 [brd-1::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov, M, et al. Cell. 2012 Aug 17;150(4):855-66. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)
TJ3000 C. elegans zSi3000. Show Description
zSi3000 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ3001 C. elegans zSi3001. Show Description
zSi3001 [hsp-16.2p::GFP::unc-54 + Cbr-unc-119(+)] II. Superficially wild-type. GFP expression after heat shock. Reference: Mendenhall A, et al. J Gerontol 2012 Jan 6.
TJ356 C. elegans zIs356 IV. Show Description
zIs356 [daf-16p::daf-16a/b::GFP + rol-6(su1006)]. Daf-c, Rol, Fluorescent DAF-16::GFP, Age, increased resistance to heat and UV. Grows and reproduces slowly. Maintain at 20C. Integrated by gamma irradiation of extrachromosomal (Ex daf-16::GFP) line. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects. April 2005: Corrigendum: daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Joshua McElwee of University College London has brought to our attention that plasmid pGP30 described in Henderson and Johnson (Current Biology 11, 1975-1980, December 2001) contains a mutation. We have confirmed the mutation in our own traces from the original sequence. Using daf-16a2 cDNA as a reference sequence (genbank accession number AF020343), pGP30 contains an A to T transversion at AF020343 position 1747:(TTCCCGATCAGCCACTGATGG(a/t)ACTATGGATGTTGATGCATTGA). This mutation results in an GAT (asp) to GTT(val) change at position 484 of the translated AF020343 sequence. The DAF-16::GFP (green fluorescent protein) protein encoded by pGP30 rescues a daf-16 null phenotype and behaves similarly to other reported DAF-16 fusion constructs (Lee et al., 2001; Lin et al., 2001). Therefore, we do not feel it alters the conclusions of the paper. We regret any inconvenience this may have caused. Samuel T. Henderson* and Thomas E. Johnson². ²Correspondence: johnsont@colorado.edu. Lee, R. Y., Hench, J., and Ruvkun, G. (2001). Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol 11, 1950-1957.Lin, K., Hsin, H., Libina, N., and Kenyon, C. (2001). Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat Genet 28, 139-145. This strain cannot be used for any commercial purpose or for work on human subjects.
TL24 C. elegans zdIs5 I; clr-1(cy14) II; slt-1(eh15) X. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. cy14 was isolated in a screen for suppressors of the AVM axon ventral guidance defect of slt-1 null mutant. cy14 is a G-to-A transition in the splice acceptor of intron 5 of clr-1 that leads to the use of a cryptic splice acceptor and consequently to an 18 bp deletion in exon 6.
TLG697 C. elegans texIs127 X. Show Description
texIs127 [spp-9p::GFP] X. GFP expression in intestine and six aphid neurons, including AWB and AWC, serves as a reporter for DBL-1 signaling (fluorescence is high when DBL-1 signaling is low, and low when DBL-1 signaling is high). This reporter is also responsive to starvation, select bacterial pathogens, and loss of other innate immune signaling pathways, including tir-1 and pmk-1 (but not sek-1 or mek-1). texIs127 created by X-ray integration of extrachromosomal array wkEx52 into N2 animals using UV/TMP. Out-crossed five times to the N2. References: Lakdawala ML, et al. Mol Biol Cell. 2019 Dec 15;30(26):3151-3160. doi: 10.1091/mbc.E19-09-0500. PMID: 31693440. Roberts AF, et al. 2010 Jun 7:10:61. doi: 10.1186/1471-213X-10-61. PMID: 20529267.
TQ2183 C. elegans lite-1(xu7) X; xuEx705. Show Description
xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TQ233 C. elegans trpa-1(ok999) IV. Show Description
Shorter lifespan than wild-type worms at 15-20 C, but not at 25 C. Reference: Xiao R, et al. Cell. 2013 Feb 14;152(4):806-17.
TQ3032 C. elegans lite-1(xu7) X; xuEx1040. Show Description
xuEx1040 [nmr-1p::G-CaMP3.0 + nmr-1p::DsRed]. Pick fluorescent animals to maintain. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
TU1366 C. elegans deg-1(u506) X. Show Description
Recessive gain-of-function. Codon 393 changed from alanine (GCT) to threonine (ACT). Deg and Tab at all temperatures. Lethal at 15C (embryos arrest at the two-fold stage, larvae survive).
TU38 C. elegans deg-1(u38) X. Show Description
Touch insensitive-at the tail. Degeneration of a small set of neurons. TAB Touch ABnormal).
TU900 C. elegans +/szT1 [lon-2(e678)] I; uDf1/szT1 X. Show Description
Heterozygotes are WT and segregate WT, Lon males and dead eggs. Maintain by picking WT. [4/98: Lon males are sickly and Unc. uDf1 appears to still be present.]
TV13570 C. elegans unc-119(ed3) III; nrx-1(wy778[unc-119(+)]) V. Show Description
wy778 is a large deletion in the nrx-1 locus that removes the transmembrane and cytoplasmic domains shared by all NRX-1 isoforms and deletes the short isoform entirely. Reference: Maro GS, et al. Neuron. 2015 Jun 17;86(6):1420-32.
TV17248 C. elegans wyIs592 III; sax-7(nj48) IV. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. nj48 is a punitive null allele of sax-7. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
TV24185 C. elegans zif-1(gk117) III; wyEx9745. Show Description
wyEx9745 [unc-86p::mCherry::PLCdeltaPH + odr-1p::GFP]. Pick GFP+ animals to maintain. zif-1(gk117) is a punitive null allele. mCherry expression in early PVD membrane. Reference: Liang X, et al. Elife. 2020 Jul 13:9:e56547. PMID: 32657271.
TV29856 C. elegans kpc-1(gk8) I; wyIs592 III. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. Fluorescent PVD- and FLP-specific morphology markers. gk8 is a punitive null allele of kpc-1. Reference: Shi R, et al. 2024 bioRxiv doi: https://doi.org/10.1101/2024.05.08.591205 PMID: 38766073.
TX174 C. elegans oma-1(zu405te33) IV. Show Description
Dominant suppressor of zu405. Putative oma-1 null. [NOTE (09/2016; D. Greenstein, unpublished results): The two molecular changes in te33 are different than reported by Detwiler et al. (2001), but nonetheless result in a strong loss of oma-1 function. Sequencing of the original isolate of te33 gave the same result (S. Robertson and R. Lin, unpublished results).] This strain carrying oma-1(zu405te33) contains the following mutations: zu405 [C8889984T; P240L] and te33 [C8889978A, S238stop & C8889863T, H200Y].
TX585 C. elegans unc-119(ed3) III; teIs18 V. Show Description
teIs18 [sdz-23p::GFP::H2B::pie-1 3'UTR + Cbr-unc-119(+)]. Superficially wild-type. Integrated array carrying sdz-23 (F58G4.4) promoter fusion with bright GFP expression in E cell. Reference: Shetty P, et al. Dev Biol. 2005 Sep 15;285(2):584-92.
TX903 C. elegans teIs90 I; unc-119(ed3) III; him-3(e1147) IV. Show Description
teIs90 [(pRL1483) pie-1p::GFP::taf-4 + unc119(+)]. Sick at high temperatures. Maintain at 20C, but it will silence after some generations.
TY1936 C. elegans dpy-30(y228) V/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, dead eggs and temperature sensitive Dpys. At 15C the y228 homozygotes (derived from heterozygous mothers) are WT and most of their progeny are inviable, dying as arrested embryos or as necrotic Uncoordinated and Constipated L1 larvae; a small number of animals survive and develop into Dpy, Egl adults with a protruding vulva. At 25C the y228 homozygotes (derived from a heterozygous mother) are Dpy and Egl and have a protruding vulva; progeny from these animals are inviable and die as embryos or L1 larvae. See also WBPaper00002302.
TY2173 C. elegans mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17 X. Show Description
The hermaphrodites are variable in phenotype, but most are Dpyish (small) and sick. Pick these hermaphrodites to maintain the strain, since healthier animals may have picked up a suppressor mutation or gone polyploid, etc. Strain gives WT males.
TY2175 C. elegans mnDp66 (X;I)/yDp14 (X;I); him-8(e1489) IV; yDf17/unc-1(e1598n1201) dpy-3(e27) X. Show Description
WT hermaphrodites whose progeny include WT hermaphrodites, Dpy hermaphrodites (mnDp66; unc-1 dpy-3), Unc hermaphrodites (yDp14; unc-1 dpy-3), DpyTra hermaphrodites (mnDp66/yDp14; yDf17), WT males, Unc males, and Dpy males. There are 2 types of WT hermaphrodites in this strain which are indistinguishable unless you score their offspring: mnDp66/yDp14; him-8; yDf17/unc-1 dpy-3 animals will have many WT males progeny; but mnDp66/yDp14; him-8; unc-1 dpy-3 animals will have primarily dpy male progeny [mnDp66/yDp14; unc-1 dpy-3 XO animals are mostly dead, but there are some escapers of lethality]. Maintain by picking L4 WT hermaphrodites and checking for correct segregation of progeny.
TY2439 C. elegans yIs33 III; him-8(e1489) IV. Show Description
yIs33 [xol-1::lacZ + rol-6(su1006)]. Rollers. XO-specific expression of lacZ fusion. Not all animals Roll.
TY4236 C. elegans him-8(e1489) IV; mIs10 V. Show Description
mIs10 [myo-2p::GFP + pes-10p::GFP + gut-promoter::GFP] V. WT GFP phenotype, with expression in 4-cell embryos, pharyngeal muscle and gut. Him. mIs10 suppresses recombination between unc-60 and dpy-11.
TY4986 C. elegans htp-3(y428) ccIs4251 I/hT2 [bli-4(e937) let-?(q782) qIs48] (I,III). Show Description
ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, htp-3(y428) ccIs4251 homozygotes that are GFP+ in body wall muscle but not pharynx, hT2 GFP+ homozygotes, and aneuploid dead embryos. Avoid picking viable aneuploids that often appear larger and longer than wild-type.
TY5120 C. elegans +/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. Show Description
Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.
TY5121 C. elegans rec-8(ok978)/nT1 IV; coh-4(tm1857) coh-3(gk112) V/nT1 [qIs51] V. Show Description
Heterozygotes are superficially wild-type GFP+, and will segregate wild-type GFP+ heterozygotes, sterile rec-8(ok978); coh-4(tm1857) coh-3(gk112) homozygotes that are GFP-, nT1 GFP+ homozygotes, and aneuploid dead embryos.
TY5684 C. elegans sdc-2(y93) X. Show Description
Temperature-sensitive. Maintain at 15C. Complements other sdc-2 alleles at 15C. At 20C animals are not Dpy or Tra, but there is a low penetrance of lethality, some Egl animals, and some animals will Bag after a couple days of egg-laying. y93 fails to complement other sdc-2 alleles at 25C; homozygotes are Egl,Tra and weakly Dpy at higher temperatures. Shifting embryos (prepared from non-Dpy non-Egl non-Tra gravid adults at 20C) from 20C to 25C is sufficient to alter their phenotype. Reference: Nusbaum C & Meyer BJ. Genetics. 1989 Jul;122(3):579-93.
TY5755 C. elegans xol-1(y684) X. Show Description
Male lethal. y684 is s a null allele caused by precise deletion of the coding sequence of xol-1. Reference: Anderson EC, et al. Dev Cell. 2019 Oct 21;51(2):192-207.e6.
UDN100028 C. elegans rab-5(udn14)/tmC18 [dpy-5(tmIs1200)] I. Show Description
Must be maintained at >20 degrees; grows better at 25C. Homozygous lethal rab-5 [D135H] mutation balanced by tmC18. Balancer marked with myo-2p::Venus. Heterozygotes are WT with pharyngeal Venus fluorescence, and segregate Venus+ heterozygotes, non-Venus rab-5[D135H] homozygotes (L1 lethal), and Dpy Venus+ tmC18 homozygotes. Pick fertile wild-type Venus+ to maintain. Silent BstAPI site added in D135H for genotyping ease. Heterozygous rab-5[D135H] animals are small and have decreased locomotion. Reference: Huang et al. 2022. PMID: 35121658
UDN100083 C. elegans unc-116(udn45)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick slightly dumpy GFP+ to maintain. Heterozygotes are slightly dumpy GFP+ (pharynx), and segregate slightly dumpy GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), non-GFP udn45 homozygotes (early larval arrest and Unc), and a few slow-growing wild-type looking or thin GFP+ heterozygotes. These thin GFP+ animals give rise to almost exclusively GFP+ progeny; a possible interaction between unb45 and qC1 is suspected. Variant edit allele T90I. TspRI restriction site created by synonymous changes for ease of genotyping. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.
UDN100154 C. elegans vps-34(udn80) I. Show Description
vps-34 [Y752C] #2. StyI restriction site created by synonymous changes, ease for genotyping. vps-34 [Y752C] are wild-type for the following phenotypes: Length, Width, Body wavelength, Crawl speed, Thrash rate, Pharyngeal Pump frequency, duration, R/E ratio, Germ cell corpse engulfment, coelomocyte endocytosis, coelomocyte size, gut vesicle size, and RAB-7(+) gut vesicle size.
UDN100161 C. elegans pph-5(udn91) V. Show Description
pph-5 [A48T] #2 variant edit from Fielder, et al. (2022). Includes addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and superficially wild-type. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100163 C. elegans pph-5(udn93) V. Show Description
pph-5 [A48A] #1 control edit for strain UDN100160 from Fielder, et al. (2022). Wild-type sequence except for addition of silent AvaII restriction site and silent PAM ablation. Homozygous viable and wild-type appearance. Genotype using primers Forward: accggaaattgtcccaaaat, Reverse: tttccgactttctggaggtg. Digest with AvaII restriction enzyme for resulting sizes of 401bp +403bp. Wild-type product will not be digested.
UDN100169 C. elegans unc-116(gk5722udn86)/qC1 [dpy-19(e1259) glp-1(q339)] nIs189 III. Show Description
Pick wild-type GFP+ to maintain. Heterozygotes are wild-type GFP+ (pharynx), and segregate wild-type GFP+ heterozygotes, Dpy Sterile GFP+ (qC1 homozygotes), and non-GFP gk5722udn86 homozygotes (larval arrest; few escapers). Derived from VC4653; selection cassette in VC4653 was removed, and then crossed with qC1 nIs189 [myo-2::GFP] balancer. nIs189 [myo-2::GFP] integrated in or near qC1. No recombination seen between nIs189 and qC1; fails to complement all markers on qC1.