| KRA448 |
C. elegans |
kasEx157. Show Description
kasEx157 [unc-11p::C9 neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KRA452 |
C. elegans |
kasEx161. Show Description
kasEx161 [unc-11p::UAG neuro + myo-2::GFP]. Pick GFP+ to maintain array. The transgene drives expression of 75 GGGGCC repeats under the control of unc-11 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KRA467 |
C. elegans |
lin-39(kas9[lin-39::mNG::AID*]) III. Show Description
mNeonGreen::3xFLAG::AID* was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.
|
|
| KRA522 |
C. elegans |
kasIs10. Show Description
kasIs10 [snb-1p::UAG ubi + myo-2::GFP]. The transgene drives expression of 75 GGGGCC repeats under the control of snb-1 promoter. The repeats are flanked with human C9orf72 intronic sequences, but the upstream CUG is mutated to UAG. Reference: Sonobe Y, et al. Nat Commun. 2021 Oct 15;12(1):6025. doi: 10.1038/s41467-021-26303-x. PMID: 34654821
|
|
| KRY84 |
C. elegans |
nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-25 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| KRY85 |
C. elegans |
ieSi57 II; nhr-25(kry59[nhr-25::AID*::TEV::3xFLAG]) X. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain allows somatic depletion of NHR-25::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY84 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| KRY87 |
C. elegans |
nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I. Show Description
AID*::TEV::3xFLAG tag inserted at the C-terminus of the endogenous nhr-23 locus by CRISPR. Allele obtained by pha-1 co-conversion, following Ward 2015 method. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| KRY88 |
C. elegans |
nhr-23(kry61[nhr-23::AID*::TEV::3xFLAG]) I; ieSi57 II. Show Description
ieSi57 [eft-3p::TIR1::mRuby::unc-54 3'UTR + Cbr-unc-119(+)] II. Strain for somatic depletion of NHR-23::AID*::TEV::3xFLAG using the auxin-inducible degron system. Derived by crossing parental strains KRY87 and CA1200. Reference: Zhang L, et al. Development. 2015 Dec 15;142(24):4374-84. doi: 10.1242/dev.129635. PMID: 26552885.
|
|
| KU801 |
C. elegans |
klc-2(km11) V. Show Description
Homozygous viable. km11 is a deletion/duplication of klc-2; see Sakamoto, et al. PMID: 15563606 for detailed description. Reference: Sakamoto R, et al. Mol Biol Cell. 2005 Feb;16(2):483-96. PMID: 15563606
|
|
| KW1973 |
C. elegans |
taf-6.2(ax701) unc-17(e113) IV. Show Description
Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).
|
|
| KW1975 |
C. elegans |
taf-6.2(ax514) unc-17(e113) IV. Show Description
Unc. Maintain at 15C. Temperature-sensitive Emb when L4 larvae are shifted to restrictive temperature (25C). L1 larvae shifted to restrictive temperature arrest and die as young larvae. Reference: Bowman EA, et al. Worm Breeder's Gazette 2011 18(4).
|
|
| KW2090 |
C. elegans |
cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2181 |
C. elegans |
cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi12 II. Show Description
ckSi12 [cdk-9(D235N)::mCherry + unc-119(+)] II. Segregates WT green-glowing heterozygotes and non-glowing cdk-9 homozygotes (arrest as L1-L2 larvae). qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2194 |
C. elegans |
ckSi17 I; unc-119(ed3) III. Show Description
ckSi17 [cdk-12::GFP::mex-5 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2195 |
C. elegans |
ckSi20 II; unc-119(ed3) III. Show Description
ckSi20 [cdk-9::mCherry::mex-5 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2196 |
C. elegans |
ckSi21 II; unc-119(ed3) III. Show Description
ckSi21 [cdk-9::GFP::pal-1 3'UTR + unc-119(+)] II. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2205 |
C. elegans |
cdk-9(tm2884) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III); ckSi21 II. Show Description
ckSi21 [cdk-9::mCherry::pal-1 3'UTR + unc-119(+)] II. mCherry is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. hT2 segregates WT green-glowing heterozygotes and non-GFP cdk-9 homozygotes (normally arrest as L1-L2 larvae; cdk-9 homozygotes carrying ckSi21 (GFP- mCherry+) are viable but sterile. qIs48 is an insertion of ccEx9747 (carries myo-2::GFP, pes-10::GFP, and a gut enhancer fused to GFP) onto the hT2 chromosome and is homozygous lethal. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2206 |
C. elegans |
ckSi26 I; unc-119(ed3) III. Show Description
ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KW2211 |
C. elegans |
ckSi26 I; cdk-12(ok3664)/qC1 [dpy-19(e1259) glp-1(q339) qIs26] III. Show Description
qIs26 [lag-2::GFP + rol-6(su1006)]. ckSi26 [cdk-12::GFP::pal-1 3'UTR + unc-119(+)] I. GFP is expressed in all somatic nuclei; expressed in germline only at end of oogenesis. Throws heterozygous Rollers, tm3846 homozygotes (Emb), and tm3846 homozygotes (arrest as L1-L2 larvae). qIs26 was integrated into qC1 and in the process made qC1 homozygous lethal. The distal tip cells are GFP+. qIs26 is an integration of qEx233. Reference: Bowman EA, et al. Development. (In Press).
|
|
| KWN190 |
C. elegans |
pha-1(e2123) III; him-5(e1490) V; rnyEx109. Show Description
rnyEx109 [nhx-2p::D3cpv + pha-1(+)]. Maintain at 20-25C to select for array. KWN190 strain expresses the FRET-based calcium indicator protein D3cpv throughout the cytoplasm of intestinal cells. Dual emission ratio imaging (ex. 435, em. 480/535-nm) can be used to measure intestinal calcium and, although the FRET pair is CFP/YFP, intestinal D3cpv fluorescence is observable under standard GFP filter sets. The D3cpv biosensor has the advantages of being relatively pH-insensitive and not interfering with endogenous calmodulin signaling. References: Am J Physiol Cell Physiol. 301:C1389-1403. Am J Physiol Cell Physiol. 297:C1071-81. FASEB J. 27:760-768. PLoS Biol. 11: e1001613.
|
|
| KWN26 |
C. elegans |
pha-1(e2123) III; rnyEx6. Show Description
rnyEx6 [nhx-2p::pHluorin + pha-1(+)]. Maintain at 20-25C to select for array. KWN26 strain expresses the pH-sensitive GFP variant pHluorin throughout the cytoplasm of intestinal cells. Dual excitation ratio imaging (ex. 410/470, em. 435-nm) can be used to measure intestinal pH and intestinal pHluorin fluorescence is observable under standard GFP filter sets. References: J Biol Chem 278:44657-44666. Curr Biol. 18: 297-302. Am J Physiol Cell Physiol. 297:C1071-81. Am J Physiol Cell Physiol.302 C1045-1054.
|
|
| KX10 |
C. elegans |
ife-3(ok191)/unc-34(e566) V. Show Description
At 20C heterozygotes segregate WT heterozygotes, Unc unc-34(e566) homozygotes, and Mog ife-3(ok191) homozygotes. At 25C ife-3(ok191) homozygotes are not always Mog, but progeny of the non-Mog homozygotes are embryonic lethal. Deletion of 686 bp from ife-3 removes proximal promoter and all of exon 1. Breakpoint determined by B. Keiper is: taattttcatattttccgct/tatcta/ttatcgattttttccagatg. Eukaryotic translation initiation factor 4E (eIF4E) gene (isoform 3; B0348.6); paralog of human eIF4E isoform.
|
|
| KX110 |
C. elegans |
ced-9(n1653)
mab-5(mu14) III; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Temperature sensitive induction of germ cell apoptosis at 25 C. Large number of germ cells are decorated by CED-1::GFP within 48 h. Activates CED-3-mediated cleavage of IFG-1, visualized by western blot (Contreras, V., et al, 2011).
|
|
| KX15 |
C. elegans |
ife-2(ok306) X. Show Description
No apparent phenotype. Outcrossed version of RB579. Deletion of 1628 bp removes ife-2 exon 4. Deletion extends into R04A9.3 and removes exons 1 and 2 of unknown gene. IFE-2 protein is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint independently determined by BDK and Vancouver KO Group is AAAACAATTTTCCACTGCT/AA/TTTTTGCAAAGTATTCAATT. Eukaryotic translation initiation factor 4E gene (isoform 2).
|
|
| KX17 |
C. elegans |
ife-4(ok320) X. Show Description
C05D9.5 Homozygous. Deletion of 1778 bp removes 1088 bp upstream of start codon and all of exons 1 and 2. IFE-4 is absent from m7GTP-affinity purified protein; other IFEs are present. Breakpoint determined by BDK is CATCGAGTCGGGACGTGATG/AGTAGTGCAAGACTGATAAA. Eukaryotic translation initiation factor 4E gene (isoform 4).
|
|
| KX54 |
C. elegans |
ifg-1(cxTi9279)
II; bcIs39 V. Show Description
bcIs39 [lim-7p::ced-1::GFP and lin-15(+)] V. Temperature-sensitive germ cell apoptosis leading to infertility at 25 C. Apoptosing germ cells are decorated by CED-1::GFP in the gonad. Loss of p170 form of IFG-1 (but not p130 IFG-1) confirmed by Western blot. Escaping eggs are fertilized and embryonic lethal. Mos-1 transposon insertion previously described as ifg-1::mos-1(cxP9279)
II; confirmed by triple primer PCR with 5-ACCAAACTGGGCAAACAAAG-3, 5-GCTCAATTCGCGCCAAACTATG-3, and 5-CTTCCTGAAATTTGGTTTAACAGT-3. Homozygous ifg-1::mos yields only 444 bp product. Outcrossed heterozygotes yield both 353 bp (wild type ifg-1) and 444 bp products.
|
|
| LA59 |
C. elegans |
spr-3(by108) X. Show Description
Superficially WT. by108 completely suppresses the Egl defect of sel-12 mutants. by108 derepresses the transcription of hop-1 in the early larval stages. This strain may not be used for commercial purposes.
|
|
| LA62 |
C. elegans |
byDf1 X. Show Description
Superficially WT. byDf1 completely suppresses the Egl defect of sel-12 mutants. byDf1 derepresses the transcription of hop-1 in the early larval stages. byDf1 is a deletion of 31,069 bases from position 3052 of cosmid F46H6 to position 6698 of cosmid C07A12 with a single A base pair insertion. byDf1 deletes F46H6.2/dgk-2, F46H6.4, F46H6.1/rhi-1, C07A12.5/spr-3 and part of C07A12.7. byDf1 is null for spr-3 by sequence and northern analysis. Deletion can be detected with the primers RB1222 CTT ACT AGT ACT AGC TCG CG and RB1224 CCT GTC CAT AAG TGC AGT CC, which give a product of 1540 bp. This strain may not be used for commercial purposes.
|
|
| LA95 |
C. elegans |
spr-4(by105) I. Show Description
Superficially WT. by1-5 strongly suppresses the Egl defect of sel-12 mutants. About 5% of spr-4(by105) I; sel-12(ar171) X double mutants are Egl. This strain may not be used for commercial purposes.
|
|
| LB10 |
C. elegans |
nuo-1(ua1)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Heterozygotes are WT and segregate WT, Paralyzed Uncs and L3 lethals. ua1 is a deletion of the first 3 full exons of the NADH-ubiquinone oxidoreductase of complex I in the mitochondrial respiratory chain.
|
|
| LB127 |
C. elegans |
atp-2(ua2) III; sDp3 (III;f). Show Description
Animals with the duplication are WT. Animals which have lost the duplication arrest at 3rd larval stage with increased life span. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.
|
|
| LB128 |
C. elegans |
atp-2(ua2) unc-32(e189)/qC1 [dpy-19(e1259) glp-1(q339)] III. Show Description
Heterozygotes are WT and segregate WT, Dpy(ts) Steriles and Uncs which arrest in the L3 larval stage. ua2 is a deletion of the first 2 exons of atp-2. atp-2 gene encodes for active site subunit of Complex V of mitochondrial respiratory chain, the ATP synthase.
|
|
| LB21 |
C. elegans |
nuo-1(ua1)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT and segregate WT (fluorescent), Dpys (highly fluorescent) and L3 lethals (non-fluorescent). GFP semi-dominantly expressed in 4-60 cell embyros, pharyngeal muscle and gut. Pharyngeal and gut GFP is easily seen in a UV dissecting microscope; early embryonic signal requires higher magnification. mIs14 occasionally crosses off mIn1[dpy-10], apparently by double recombination. mIs14 is ccEx9747 integrated into mIn1[dpy-10]. This is a three-construct element containing myo-2 and pes-10 promoters and a gut enhancer fused individually to GFP coding sequence. Called LB21B.
|
|
| LB25 |
C. elegans |
nuo-1(ua1) II; unc-119(ed3) III; uaEx25. Show Description
uaEx25 [(p016bA352V) nuo-1(+) + unc-119(+)]. Contains extrachromosomal nuo-1(A352V) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of the transgene. Low brood size. Short life span. Sensitive to oxidative stress.
|
|
| LB26 |
C. elegans |
nuo-1(ua1) II; unc-119(ed3) III; uaIs26. Show Description
uaIs26 [(p016bT434M) nuo-1(+) + unc-119(+)]. Carries integration of nuo-1(T434M) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Site of integration unknown. Moderate brood size. Shorter life span. Sensitive to oxidative stress.
|
|
| LB27 |
C. elegans |
nuo-1(ua1) II; unc-119(ed3) III; uaEx27. Show Description
uaEx27 [(p016bA443F) nuo-1(+) + unc-119(+)]. Contains an extrachromosomal array carrying nuo-1(A443F) in a plasmid derived from pDP#MM016b. Complements both nuo-1(ua1) and unc-119(ed3). Generated via microparticle bombardment, therefore, most likely low-copy expression of transgene. Low brood size. Short life span. Sensitive to oxidative stress.
|
|
| LC105 |
C. elegans |
unc-46(e177) dpy-11(e224) uIs69 V. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Dpy, Unc. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (BC277 x N2 Male) x TU3401. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
| LC108 |
C. elegans |
uIs69 V. Show Description
uIs69 [(pCFJ90) myo-2p::mCherry + unc-119p::sid-1]. Hypersensitive neuronal RNAi by feeding. Superficially wild-type. Maintain 15-20 degrees. [NOTE: uIs69 is closely linked and maps to the right of dpy-11. (C. Loer 08/2011)] Derived from (unc-46(e177) uIs69) x N2 Male. Reference: Calixto et al. (2010) Nature Methods 7:554-9.
|
|
| LC35 |
C. elegans |
cat-4(ok342) V. Show Description
T21C9.2, F32G8.6. Serotonin-deficient by anti-serotonin staining. Bleach hypersensitive. Likely also dopamine-deficient (but not tested). Slightly sickly. External left primer: TTTCTTTTCTTGTTGCGCCT. External right primer: TCGAAAAAGTCTGCTTCGGT. Internal left primer: CGTCTTCCGTTTCTTTTTCG. Internal right primer: TCTTGGAATGTGGGATGTGA. Internal WT amplicon: 2497 bp. Deletion size: 2238 bp. Deletion left flank: CGACTAGATTGATTTCCTTCTGTCCCTTCA. Deletion right flank: CTTGACGGAACAACGCCTCGATCTGATCTC. This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. URL: http://www.celeganskoconsortium.omrf.org.
|
|
| LE1090 |
C. elegans |
tiam-1(ok772) I; ced-10(n1993) lqIs3 IV. Show Description
lqIs3 [osm-6::GFP] IV. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011 (Submitted).
|
|
| LE1112 |
C. elegans |
tiam-1(ok772) I; mig-2(mu28) lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
|
|
| LE2336 |
C. elegans |
lqIs128. Show Description
lqIs128 [unc-25p::MYR::unc-40(constitutively active)::GFP + unc-25p::GFP]. Contains a myristylated, constitutively-active form of UNC-40. Slightly Unc. Reference: Norris AD & Lundquist EA. Development. 2011 Oct;138(20):4433-42.
|
|
| LE2418 |
C. elegans |
unc-73(rh40) tiam-1(ok772) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
|
|
| LE2513 |
C. elegans |
tiam-1(tm1556) I; ced-10(n1993) lqIs3 IV. Show Description
lqIs3 [osm-6::GFP] IV. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
|
|
| LE2514 |
C. elegans |
tiam-1(tm1556) I; mig-2(mu28) lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
|
|
| LE2517 |
C. elegans |
tiam-1(tm1556) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)].Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
|
|
| LE2685 |
C elegans |
egl-20(lq42) lqIs80 IV; lqIs58 V. Show Description
lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. PQR migration defects: PQR in the head in the normal position of AQR. lq42 is a premature stop codon in egl-20. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Josephson M, et al. PLos One. 2016 Feb 10;11(2):e0148658. doi: 10.1371/journal.pone.0148658. PMID: 26863303.
|
|
| LE2717 |
C. elegans |
unc-73(rh40) tiam-1(tm1556) I; lqIs2 X. Show Description
lqIs2 [osm-6::GFP + lin-15(+)]. Maintain under normal conditions. Reference: Demarco RS, Struckhoff EC, Lundquist EA. PLoS Genetics 2011.
|
|
| LE2946 |
C elegans |
cdh-4(lq83) III; lqIs80 IV; lqIs58 V. Show Description
lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq83 is a hypomorphic allele of cdh-4. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.
|
|
| LE3044 |
C elegans |
cdh-4(lq97) III; lqIs80 IV; lqIs58 V. Show Description
lqIs80 [SCMp::GFP::caax] IV. lqIs58 [gcy-32::CFP] V. AQR and PQR migration defects. lq97 is a hypomorphic allele of cdh-4. GFP expression in seam cells. CFP expression in AQR, PQR and URXL/R. Reference: Sundararajan L. et al. Dev Biol. 2014 Aug 15;392(2):141-52. doi: 10.1016/j.ydbio.2014.06.009. PMID: 24954154.
|
|