Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.

F13B10.1a Homozygous. Outer Left Sequence: GCAATCAAAGTTTCCAGCGT. Outer Right Sequence: CCTTGTCCTACTCAGCCAGC. Inner Left Sequence: AGATAAAGTCGGCAACCTGC. Inner Right Sequence: CAAATGGCGATCTGTACCCT. Inner Primer PCR Length: 3224. Estimated Deletion Size: about 1900 bp. From Nathalie Pujol 11/04: breakpoints, with a 8 bases insertion, AAATGTCGCCGGATCGTGAACTTGCAAGAAT/AGAATAAA/TGTAGACAGTGCTGGCGT AATTCGCCCA. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B10.1. Homozygous. Outer Left Sequence: CGGGAGATAGAAGGCATCTG. Outer Right Sequence: ACGGGGCTTAATTTCCTCAT. Inner Left Sequence: AAACCTTCGAAAATCGAGCA. Inner Right Sequence: CTGCCAGTCCTGTTGCTCTT. Inner Primer PCR Length: 1356 bp. Deletion Size: 354 bp. Deletion left flank: ATTTGTGAGCATTTGGTAGGTGTAAACAGA. Deletion right flank: GGAGGCCACTTCTTTTAATGCTTGGATTGC. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

F13B10.1a. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807

Enhanced pathogen susceptibility. Egg laying in response to food is defective. Reference: Shivers RP et al., (2009) Cell Host Microbe 6:321-30.

frIs7 [nlp-29p::GFP + col-12p::DsRed] IV. Reference: Pujol N, et al. PLoS Pathog. 2008 Jul 18;4(7):e1000105.

kyIs140 [str-2::GFP + lin-15(+)] I. Him. In tir-1 mutants str-2::GFP is expressed in both AWC neurons.

osIs158 [eft-3p::ccvTIR-1(F79G)::mRuby] single copy inserted into ttTi5605 on LG II. ieSi58 [eft-3p::degron::GFP::unc-54 3'UTR + Cbr-unc-119(+)] IV. This strain expresses the improved version of TIR1 used for improved auxin-inducible degradation (AID2) technology. Reference: Negishi T, et al. Genetics. 2021 Dec 2;iyab218. doi: 10.1093/genetics/iyab218.

mNeonGreen::3xFLAG::AID was inserted at the C-terminus of the endogenous lin-39 locus by CRISPR. Endogenous lin-39 expression marked by mNG. LIN-39 protein can be degraded by Auxin application with expression of TIR-1 protein. Reference: Feng W, et al. Elife. 2020 Jan 3;9. pii: e50065. doi: 10.7554/eLife.50065.

hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Degron and mNeonGreen tag inserted at the 3' end of the endogenous daf-2 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-2 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

hqSi12 [eak-4p::TIR-1:mRuby::unc-54 3' UTR + Cbr-unc-119(+)] IV. Maintain at 15C. GFP tag and degron inserted at the 3' end of the endogenous daf-16 gene locus by CRISPR/Cas9 engineering. hqSi12 was generated by replacing the sun-1 promoter and 3' UTR of the ieSi38 insertion (cxTi10882 site) with the eak-4 promoter and unc-54 3'UTR using CRISPR/Cas9. This strain can be used for auxin-inducible degradation (AID) of DAF-16 protein in the XXX cells. hqSi12 previously known as hq388. Reference: Zhang Y, et al. BioRxiv. 2021 Aug 2. 2007.2031.454567. https://doi.org/10.1101/2021.07.31.454567.

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. Degron tag was inserted into the endogenous spe-44 locus in the JU2526 wild isolate background, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Reference: Kasimatis, KR et al. (2020) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605

fxSi1 [pie-1p::TIR-1::mRuby::unc-54 3' UTR + loxP, I: 2851003] I. fxSi4 [hsp-16.41p::PEEL-1::tbb-2 3'UTR + loxP, II: 8420157] II. fxSi6 [hsp-16.41p::PEEL-1::tbb-2 3' UTR + rpl-28p::mKate2::unc-54 3'UTR + rps-0p::HygR::unc-54 3' UTR, III: 10158855] III. Heat-shock strain can be maintained at 20C without any issues. Degron tag was inserted into the endogenous spe-44 locus, allowing auxin-inducible spermatogenesis arrest and reversible male sterility. Heat-shock-induced expression of PEEL-1 will cause lethality in both sexes. fxSi4 was originally inserted in a CB4845 background, but has been sufficiently backcrossed so that PX658 is >98.5% JU2526 genetic background. Reference: Kasimatis, KR. et al. (2021) Post-Insemination Selection Dominates Pre-Insemination Selection in Driving Male Competitive Ability. bioRxiv doi: https://doi.org/10.1101/2021.06.23.449605