Search Strains

More Fields
Strain Species Genotype Add
VS27 C. elegans rde-11(hj37) IV. Show Description
RNAi defective. Reference: Genes Dev. 2012 Apr 15;26(8):846-56.
VS29 C. elegans hjSi56 IV. Show Description
hjSi56 [vha-6p::3xFLAG::TEV::GFP::dgat-2::let-858 3'UTR]. Targeting construct derived from pCFJ178. Reference: Xu N, et al. J Cell Biol. 2012 Sep 3;198(5):895-911.
VT3111 C. elegans maIs392 II; mir-83(n4638) IV. Show Description
maIs392 [lag-2p::mir-83 + Cbr-unc-119(+)] II. Reference: Burke SL, Hammell M, Ambros V. Genetics. 2015 Jun 15.
VT3297 C. elegans maIs105 V; mir-793(ma292) X. Show Description
maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
VT3299 C. elegans mir-795(ma298) I; maIs105 V. Show Description
maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
VT3301 C. elegans mir-794 mir-795(maDf5) I. Show Description
mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
VT3500 C. elegans wIs51 V; hbl-1(ma354) X. Show Description
wIs51 [SCMp::GFP + unc-119(+)] V. GFP expression in seam cells. Gain-of-function allele causing retarded heterochronic defects including extra seam cells and absence of alae in young adult animals. ms354 is a 1120 bp deletion removing most of the hbl-1 3'UTR including all let-7-complementary sites. Sequences flanking the deletion: TTCTAATCATGGCCAGTTTCTTGCA and GTGCGTTCTTCTGTCATCATGTACA. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
VT3751 C. elegans maIs105 V; hbl-1(ma430[hbl-1::mScarlet-I]) X. Show Description
maIs105 [col-19::GFP] V. hbl-1(ma430) is a CRISPR/Cas9-edited allele, which contains a linker and the mScarlet-I sequence integrated in-frame with hbl-1. Reference: Ilbay O & Ambros V. Curr Biol. 2019 Jun 3;29(11):1735-1745.e4.
VT3923 C. elegans maIs105 V; daf-12(ma498[daf-12::mScarlet-I]) X. Show Description
maIs105 [col-19p::GFP] V. mScarlet-I tag inserted at C-terminus of endogenous daf-12 locus through CRISPR/Cas9-engineering. Reference: Ilbay O & Ambros A. Development. 2019 Oct 9. pii: dev.183111. doi: 10.1242/dev.183111.
VT581 C. elegans dpy-5(e61) lin-28(n719) I; lin-46(ma164) unc-76(e911) V. Show Description
Dpy Unc. Egl+. lin-46 suppresses precocious Egl- phenotype of lin-28. lin-46 alone makes gaps in adult alae; enhanced at 15C.
VT664 C. elegans lin-28(n719) I; nIs2 IV. Show Description
nIs2 [lin-11::lacZ + lin-11(+)] IV. Egl. Integrated on IV near dpy-20.
VT733 C. remanei ssp. vulgaris Show Description
Male-female strain. Reference WBG 11(4):89. See also WBPaper00001874. May crawl off the plates. Isolated by Bill Fixsen at a rest area on the turnpike in Conn. Previously called WS9-6 and C. vulgaris NH and C. vulgariensis by the CGC. Walter Sudhaus has tentatively described this strain as C. remanei ssp. vulgaris; this description is not official and is contigent upon its being published. See WBPaper00002633.
VZ892 C. elegans hlh-30(syb1452 [hlh-30::3xFLAG::eGFP]) IV. Show Description
3xFLAG and eGFP tags inserted into the endogenous hlh-30 locus. Superficially wild-type. Diffuse GFP in basal growing conditions and strong nuclear labeling upon diverse stresses like starvation, Staphylococcus aureus infection, arsenite, diethylmaleate, heat shock or levamisole. GFP expression is only visible at high magnification; not discernible with a fluorescence stereoscope. Insertion can be detected by PCR. Forward primer sequence: 5' acgcacgcaactgcttta; Reverse primer (in 3'UTR): 5' aataacctgcgattctgg; Reverse primer (in eGFP): CTTGAAGAAGATGGTACGCTC. Expected products (For&Rev 3'UTR): 910 bp (WT)/1878 bp (syb1452). Expected products (For&Rev eGFP): no band (WT)/811 bp (syb1452). Insertion allele generated by SunyBiotech and out-crossed twice with VZ Lab N2. Reference: Martina JA, et al. EMBO J. 2021 Feb 1;40(3):e105793
WB141 C. elegans pat-6(st561) IV; zpEx99. Show Description
zpEx99 [pat-6::GFP + rol-6(su1006)]. Rollers. Pick Rollers to maintain. zpEx99 produces a fully functional GFP-tagged pat-6 protein that localizes to the dense bodies in muscle cells. Rescues the lethal phenotype of pat-6(st561) homozygous animals. Reference: Lin X, et al. Curr Biol. 2003 May 27;13(11):922-32.
WBM1231 C. elegans wbmIs97 *wbmIs65. Show Description
wbmIs97 [eft-3p::tomm-20(aa1-49)::GFP::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::GFP expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::GFP downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
WBM1232 C. elegans wbmIs98 *wbmIs65. Show Description
wbmIs98 [eft-3p::tomm-20(aa1-49)::mCherry::unc-54 3'UTR] *wbmIs65. Somatic-specific TOMM-20(1-49)::mCherry expression driven by the eft-3p promoter allows imaging of mitochondria without some of the adverse side effects of extrachromosomal arrays. Derived by CRISPR-mediated insertion of TOMM-20::mCherry downstream of tissue-specific eft-3 promoter of wbmIs65 insertion in parental strain WBM1140. wbmIs65 [eft-3p::3XFLAG::dpy-10 crRNA::unc-54 3'UTR] (V:8645000). Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
WBM1444 C. elegans tomm-70(wbm81[tomm-70::GFP]) III. Show Description
GFP tag inserted at the C-terminus of the endogenous tomm-70 locus using CRISPR/Cas9. TOMM-70::GFP expressed in mitochondrial outer membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
WBM1688 C. elegans scpl-4(wbm108[scpl-4::wrmScarlet]) V. Show Description
wrmScarlet tag inserted at the C-terminus of the endogenous scpl-4 locus using CRISPR/Cas9. C.elegans ortholog of human TIMM50 translocase of inner mitochondrial membrane 50. SCPL-4::wrmScarlet expression in inner mitochondrial membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
WBM1689 C. elegans tomm-70(wbm81[tomm-70::GFP) III; scpl-4(wbm108[scpl-4::wrmScarlet]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous tomm-70 locus using CRISPR/Cas9. wrmScarlet tag inserted at the C-terminus of the endogenous scpl-4 locus using CRISPR/Cas9. TOMM-70::GFP expressed in mitochondrial outer membrane. SCPL-4::wrmScarlet expression in inner mitochondrial membrane. Reference: Valera-Alberni M, et al. Life Science Alliance Sep 2024, 7 (11) e202402918; DOI: 10.26508/lsa.202402918. PMID: 39071403.
WH33 C. elegans stu-11(oj18). Show Description
Temperature sensitive - maintain at 16C. L1 shift-up to 25C produces incompletely penetrant sterile Unc phenotype. L4 shift-up produces leaky Mel phenotype. Unmapped.
WH347 C. elegans unc-119(ed3) III; ojIs35. Show Description
ojIs35 [pie-1::GFP::rab-11.1 + unc-119(+)].
WM101 C. elegans unc-24(e138) oma-1(ne411) IV; lon-2(e678) X. Show Description
Lon. Maintain at 15C. Produces dead eggs at 25C.
WM120 C. elegans sago-2(tm894) ppw-1(tm914) I; C06A1.4(tm887) wago-4(tm1019) II; M03D4.6(tm1144) IV; sago-1(tm1195) V; neIs11 X. Show Description
neIs11 [myp-3::GFP::sago-1 + rol-6(su1006)]. Transgene rescues muscle RNAi defect. Rollers.
WM191 C. elegans sago-2(tm894) ppw-1(tm914) ppw-2(tm1120) wago-2(tm2686) wago-1(tm1414) I; wago-11(tm1127) wago-5(tm1113) wago-4(tm1019) II; hrde-1(tm1200) sago-1(tm1195) III; wago-10(tm1186) V; nrde-3(tm1116) X. Show Description
Maintain at 15 C. MAGO12 mutant. RNAi resistant. Temperature sensitive. Reference: Gu, et al. 2009 Mol Cell 36:234-44.
WM43 C. elegans gex-3(zu196) IV/nT1 [unc-?(n754) let-?] (IV;V). Show Description
Heterozygotes are Unc and segregate Unc, WT which give only dead eggs, and dead eggs. Zygotic phenotype: 100% of gex-3 homozygotes become Egl although they all make a normal looking L3/L4 vulva. Embryonic phenotype: complete loss of morphogenesis - hypodermal cells fail to intercalate or migrate. Received new stock from Erik Lundquist 11/2003.
WRM12 C. elegans sprSi11 II; unc-119(ed3) III. Show Description
sprSi11 [mex-5p::MODC PEST::GFP::H2B::cul-4 3'UTR + Cbr-unc-119(+)] II. Reference: Kaymak et al., Dev Dyn. 2016 Sep;245(9):925-36.
WU1036 C. elegans natc-1(am138) V. Show Description
natc-1(am138) mutant animals are resistant to excess dietary zinc, cadmium, nickel, and copper. natc-1(am138) animals are also resistant to excess heat and oxidative stress while displaying reduced lifespan. References: Warnhoff K, et al. PLoS Genet. 2014 Oct 16;10(10):e1004703. Bruinsma JJ, et al. Genetics. 2008 Jun;179(2):811-28.
WU48 C. elegans lin-45(n2018) dpy-20(e1282) IV. Show Description
Intermediate severity of lin-45 raf allele: at 20C, 76% larval lethal and 24% display an abnormal vulva (either Egl, no discernable vulva, or PVul). Medium Dpy. Received new stock 11/2002.
WU970 C. elegans haly-1(am132) X. Show Description
Resistance to excess dietary zinc and nickel observed on noble agar minimal media with supplemental zinc or nickel; elevated levels of histidine observed in C. elegans on minimal media. Reference: Murphy JT, et al. PLoS Genet. 2011 Mar;7(3):e1002013.
WU971 C. elegans haly-1(am130) X. Show Description
Resistance to excess dietary zinc and nickel observed on noble agar minimal media with supplemental zinc or nickel; elevated levels of histidine observed in C. elegans on minimal media. Reference: Murphy JT, et al. PLoS Genet. 2011 Mar;7(3):e1002013.
WU982 C. elegans natc-1(am134) V. Show Description
natc-1(am134) mutant animals are resistant to excess dietary zinc. References: Warnhoff K, et al. PLoS Genet. 2014 Oct 16;10(10):e1004703. Bruinsma JJ, et al. Genetics. 2008 Jun;179(2):811-28.
WUM73 C. elegans drl-1(vir11) IV; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Sandoval LE, et al. J Virol. 2019 Jan 17;93(3):e01400-18. doi: 10.1128/JVI.01400-18. PMID: 30429346.
WUM79 C. elegans hipr-1(vir13) III; rde-1(ne219) V; jyIs8. Show Description
jyIs8 [pals-5p::GFP + myo-2p::mCherry]. Orsay virus infection defect. Reference: Jiang H, et al. Proc Natl Acad Sci USA. 2020 Sep 8;117(36):22462-22472. doi: 10.1073/pnas.2006914117. PMID: 32839311.
XA3101 C. elegans paf-1(tj11) I. Show Description
Superficially WT.
XA4900 C. elegans rib-2(qa4900)/qC1 [dpy-19(e1259) glp-1(q339) III. Show Description
Heterozygotes are WT and segregate WT and Sterile Dpys. Homozygous rib-2(qa4900) animals give homozygous F2 animals that can develop to the adult stage but exhibit abnormal phenotypes such as egg-laying defects, increased body width, and reduced activity in movement. While the F2 qa4900 homozygotes are fertile, the F3 qa4900 homozygous progeny stop developing during gastrulation and fail to develop normally. 511 bp deletion in the region of intron2 to exon 6 of the rib-2 gene (K01G5.6).
XA5000 C. elegans che-11(qa5000) Show Description
Resistant to paraquat (methyl viologen). Dyf phenotype. Extended lifespan. mev-4 = che-11.
XA7401 C. elegans R09B5.11(ok1759) V. Show Description
R09B5.11 Homozygous. Outer Left Sequence: ctgtcgcaagtcctgattga. Outer Right Sequence: gtttccggaacaaacttcca. Inner Left Sequence: gaacgagtgtttctgggacg. Inner Right Sequence: atgaggaaggcgtactggtg. Inner Primer PCR Length: 3113. Deletion size: 1273 bp. Left flank: TATCAGTTTGAAGAGGCACTCGAAAACCTT. Right flank: ACTGTTCTATATATAAGCTGAAGTTCAACC. This strain was provided by the C. elegans Gene Knockout Project at OMRF, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. http://www.mutantfactory.ouhsc.edu/
XA763 C. elegans gly-18(qa704) I. Show Description
Phenotypically wild type. F22D6.11
XA8106 C. elegans hcf-1(pk924) IV. Show Description
Pleiotropic defects including reduced broodsize, reduced levels of histone H3 serine 10 phosphorylation, cold-sensitive embryonic lethality, cold-sensitive early embryonic mitotic and cytokinetic defects. Reference: Lee S, et al. PLoS One. 2007 Nov 28;2(11):e1213.
XE1037 C. elegans geIs3 I; dpy-11(e224) V; oxIs12 X. Show Description
geIs3 [sir-2.1(+) + rol-6(su1006)] I. oxIs12 [unc-47p::GFP] X. GFP expression in GABA neurons. Rollers. Dpy. Reference: Byrne AB, et al. Neuron. 2014; 81(3):561-73.
XE1057 C. elegans eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1203 C.elegans sup-17(n316) zdIs5 I. Show Description
zdIs5 [mec-4p::GFP + lin-15(+)] I. Axon regeneration is significantly improved in ADAM10/sup-17(n316) loss-of-function mutants. Reference: El Bejjani R & Hammarlund M. Neuron. 2012 Jan 26;73(2):268-78. doi: 10.1016/j.neuron.2011.11.017. PMID: 22284182.
XE1311 C. elegans mkk-4(ju91) X; vtIs7. Show Description
vtIs7 [dat-1p::GFP]. GFP expression in dopaminergic neurons. This strain was generated by crossing the mkk-4(jk91) mutation into the vtIs7 background. Reference: Gonzalez-Hunt CP, et al. PLoS One. 2014 Dec 8;9(12):e114459.
XE1375 C. elegans wpIs36 I; wpSi1 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpIs36 [unc-47p::mCherry] I. wpSi1 [unc-47p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. GABAergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the GABAergic neurons; all other tissues are resistant to RNAi. Superficially wild type with mCherry fluorescence in the GABA motor neurons. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1474 C. elegans wpSi6 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi6 [dat-1p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Dopaminergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the dopaminergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1581 C. elegans wpSi10 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi10 [unc-17p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Cholinergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the cholinergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1582 C. elegans wpSi11 II; eri-1(mg366) IV; rde-1(ne219) V; lin-15B(n744) X. Show Description
wpSi11 [eat-4p::rde-1::SL2::sid-1 + Cbr-unc-119(+)] II. Maintain at 15-20C, sterile at 25C. Superficially wild-type. Glutamatergic neuron-specific RNAi strain. Sensitivity to feeding RNAi is limited to the glutamatergic neurons; all other tissues resistant. Reference: Firnhaber C & Hammarlund M. PLoS Genet. 2013 Nov;9(11):e1003921.
XE1593 C. elegans daf-16(mu86) I; wpSi14 II; daf-2(e1370) III. Show Description
wpSi14 [rgef-1p::GFP::daf-16A + Cbr-unc-119(+)] II. Reference: Byrne AB, et al. Neuron. 2014 Feb 5;81(3):561-73. doi: 10.1016/j.neuron.2013.11.019. PMID: 24440228
XE2046 C. elegans oyIs14 ric-7(n2657) V. Show Description
oyIs14 [sra-6p::GFP + lin-15(+)]. sra-6p::GFP marks both PVQ neurons as well as the ASI and ASH neurons in the head. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.
XE2260 C. elegans casy-1(wp78) II. Show Description
wp78 is a CRISPR/Cas9-engineered 11.5 kb deletion removing the entire coding region of casy-1, the C. elegans homolog of calsyntenin. casy-1(wp78) phenocopies the casy-1(wp60) point mutation and strongly suppresses PVQ degeneration in both ric-7(n2657) and miro-1(wy50180); mtx-2(wy50266) mutants. Reference: Ding C, et al. Elife. 2022 Mar 14;11:e73557. PMID: 35285800.