Strain Information
| Name | VT3297 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | maIs105 V; mir-793(ma292) X. |
| Description | maIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11]. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Orkan Ilbay |
| Laboratory | VT |
| Reference | N/A. |
Sign in
or
register an account if you want to order this strain.