Strain Information

Name VT3297   View On Wormbase
Species C. elegans
GenotypemaIs105 V; mir-793(ma292) X.
DescriptionmaIs105 [col-19::GFP] V. mir-793(ma292) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma292 allele is missing the 220 nucleotide region between ACCGAGCAAGTTAGAAATCACCGCC and GTATGAATGTTTTTCCTTCAAACAT [chrX:13,857,855-13,858,124 of WBcel235/ce11].
MutagenCrispr/Cas9
Outcrossedx2
Made byOrkan Ilbay
Laboratory VT
Reference N/A.
Sign in or register an account if you want to order this strain.