Strain Information
| Name | VT3299 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | mir-795(ma298) I; maIs105 V. |
| Description | maIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11]. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x3 |
| Made by | Orkan Ilbay |
| Laboratory | VT |
| Reference | N/A. |
Sign in
or
register an account if you want to order this strain.