Strain Information

Name VT3299   View On Wormbase
Species C. elegans
Genotypemir-795(ma298) I; maIs105 V.
DescriptionmaIs105 [col-19::GFP] V. mir-795(ma298) enhances retarded phenotypes of mir-48 mir-241 (nDF51). ma298 allele is missing the 5 nucleotides between CCGAGAAACGTTACCTGCT and AGATTGATCAGCGAGCTTGA [chrI:12,594,565-12,594,608 of WBcel235/ce11].
MutagenCrispr/Cas9
Outcrossedx3
Made byOrkan Ilbay
Laboratory VT
Reference N/A.
Sign in or register an account if you want to order this strain.