Strain Information
| Name | VT3301 View On Wormbase |
|---|---|
| Species | C. elegans |
| Genotype | mir-794 mir-795(maDf5) I. |
| Description | mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11]. |
| Mutagen | Crispr/Cas9 |
| Outcrossed | x2 |
| Made by | Orkan Ilbay |
| Laboratory | VT |
| Reference | N/A. |
Sign in
or
register an account if you want to order this strain.