Go to the U of M home page

Caenorhabditis Genetics Center (CGC)

    • Sign In

    Strain Information

    Name VT3301   View On Wormbase
    Species C. elegans
    Genotypemir-794 mir-795(maDf5) I.
    Descriptionmir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
    MutagenCrispr/Cas9
    Outcrossedx2
    Made byOrkan Ilbay
    Laboratory VT
    Reference N/A.
    Sign in or register an account if you want to order this strain.
    • Job Opportunities within the CGC
    • CGC Home
    • Search Strains
    • Register
      (existing labs)
    • Request a Lab Code
      (new labs)
    • Strain List
      • Recently Added Strains
      • Endogenously-tagged Loci
      • Wild Isolates
        (Caenorhabditis sp.)
      • Wild Isolates
        (non-Caenorhabditis sp.)
      • Strain List (text file)
    • Strain Donation
      (Users must be signed in)
    • Request Knockout
      (of Alzheimer's related genes)
    • Lab List
    • Acknowledging the CGC
    • Contact
    • Frequently Asked Questions (FAQs)
    • Conditions Of Use

    • What Is C. elegans?
    • Nomenclature

    • CeNDR - the C. elegans Natural Diversity Resource
    • WormAtlas
    • WormBase
    • National Bioresource Project for the Experimental Animal
      C. elegans
    • WormBuilder
    • WormBook
    • WormBook in Genetics