Strain Information

Name VT3301   View On Wormbase
Species C. elegans
Genotypemir-794 mir-795(maDf5) I.
Descriptionmir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11].
MutagenCrispr/Cas9
Outcrossedx2
Made byOrkan Ilbay
Laboratory VT
Reference N/A.
Sign in or register an account if you want to order this strain.