Search Strains

CRISPR/Cas9 engineered deletion of mdf-2 in which the mdf-2 coding sequence was replaced by unc-119. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (low brood size/embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Unknown if unc-119(ed3) from parental strain is still carried in the background. gRNA sequence: Gccaaattccccagttttag Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi592 [spd-2p::gfp::spd-5(S653A S658A, re-encoded) + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled gamma tubulin. GFP-labeled centrioles. Derived by crossing parental strains OD1801 with OD1709. Reference: Woodruff JB, et al. Science. 2015 May 15;348(6236):808-12. doi: 10.1126/science.aaa3923. PMID: 25977552

ltSi249 [dlg-1p(delta)7::dlg-1::GFP::unc-54 3'UTR Cbr-unc-119(+)] I. ltSi511 [cnd-1p::mCherry::PH::unc-54 3'UTR Cbr-unc-119(+)] II. During embryogenesis epidermal cell junctions fluoresce green and neuronal cell surface fluoresces red. Reference: Wang S, et al. Development. 2019 Apr 11;146(7):dev174029. doi: 10.1242/dev.174029. PMID: 30890570.

GFP inserted at the C terminus of plk-1 followed by LoxP generated by Cre-mediated excision of unc-119(+) cassette. Reference: Martino L. et al. Dev Cell. 2017 Oct. 23; 43(2):157-171.

ltSi794 [dpy-7p::vhhGFP4::zif-1::unc-54 3'UTR + Cbr-unc-119(+)] II. Hypodermal-specific anti-GFP nanobody fused to ZIF-1 (Mediated by recruited ZIF-1 but NOT requiring ZF1 tags) mediates hypodermis-specific degradation of GFP-tagged proteins. Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine hypodermis-specific functions of target genes. Reference: Wang S, et al. Elife. 2015 Sep 15;4:e08649. Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

ltSi910 [elt-2p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Intestinal-specific expression of anti-GFP nanobody fused to ZIF-1 mediates intestine-specific degradation of GFP-tagged proteins (mediated by recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine intestine-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

ltSi912 [myo-3p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Muscle-specific expression of anti-GFP nanobody fused to ZIF-1 mediates body wall muscle-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine body wall muscle-specific functions of target genes. Reference: Wang S, et al. Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

ltSi914 [osm-6p::vhhGFP4::zif-1::operon-linker::mCherry::his-11::tbb-2 3'UTR + Cbr-unc-119(+)] II. Sensory neuron-specific expression of anti-GFP nanobody fused to ZIF-1 mediates sensory neuron-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine sensory neuron-specific functions of target genes. Reference: Wang S, et al.  Development. 2017 Jun 15. pii: dev.150094. doi: 10.1242/dev.150094.

ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. Touch response neuron (TRN)-specific expression of anti-GFP nanobody fused to ZIF-1 mediates TRN-specific degradation of GFP-tagged proteins (through recruited ZIF-1 but NOT requiring ZF1 tags). Can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine TRN neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

ltSi1 [knl-1p::knl-1(re-encoded)::RFP + Cbr-unc-119(+)] II. KNL-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Espeut J, et al. Cell Rep. 2015 Jul 7;12(1):58-65. doi: 10.1016/j.celrep.2015.05.039. PMID: 26119738

mCherry tag inserted at N-terminus of endogenous knl-1 locus using by CRISPR/Cas9 engineering. Reference: Cheerambathur DK, et al. Dev Cell. 2019 Mar 25;48(6):864-872.e7. doi: 10.1016/j.devcel.2019.02.002. PMID: 30827898

CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

mNeonGreen and Flag tags inserted at 3' end of endogenous cyb-1 locus using CRISPR/Cas9 engineering. gRNA sequence: atgcgtccacttttgcattc Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi448 [csr-1p::GFP::csr-1(re-encoded; GFP inserted after aa #5 of isoform b) + Cbr-unc-119(+)] II. ItIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1764; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). [NOTE: it is not known if unc-119(ed3) is still present in the background of this strain.] Derived from strain OD1463; transgene rescues csr-1, so the balancer is not needed to maintain transgenic strain. Reference: Gerson-Gurwitz A, et al. Cell. 2016 Apr 7;165(2):396-409.

mNeonGreen and Flag tags inserted at 5' end of endogenous cyb-3 locus using CRISPR/Cas9 engineering. Strain has lethality and brood size defects. gRNA sequence: tgaagtcaggtcgacattct Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1129 [spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II. Re-encoded spd-5 is siRNA-resistant. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1219 [spd-2p::spd-5(S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. Small centrosomes. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1232 [spd-2p::spd-5(S170A T178A T198A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi569 [CEOP3608 tbg-1::mCherry + Cbr-unc-119(+)] inserted into oxTi185 [ttTi5605 + NeoR(+) + unc-18(+)] I. ltSi1539 [spd-2p::GFP::spd-5 S170A T178A T198A::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled microtubules. GFP-labeled centrosomes. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi220 [mex-5p::GFP::tbb-2::operon-linker::mCherry::his-11 + Cbr-unc-119(+)] I. ltSi1561 [spd-2p::spd-5(S170A T178A T198A S653A S658A)::spd-5 3'UTR + Cbr-unc-119(+)] II. mCherry-labeled histones. GFP-labeled microtubules. Reference: Ohta M, et al. J Cell Biol. 2021 Feb 1;220(2):e202009083. doi: 10.1083/jcb.202009083. PMID: 33399854.

ltSi240 [csr-1p::csr-1(re-encoded) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). Reference: Gerson-Gurwitz, et al. Cell. 2016 Apr 7;165(2):396-409.

ltSi242 [csr-1p::csr-1(re-encoded; D606A, D681A: isoform b numbering) + Cbr-unc-119(+)] II. The csr-1 coding sequence in the transgene was re-encoded for RNAi-resistance (see Gerson-Gurwitz A, et al. Cell. 2016, Supplementary Figure S3A). Reference: Gerson-Gurwitz, et al. Cell. 2016 Apr 7;165(2):396-409.

ltIs37 [pie-1p::mCherry::his-58 + unc-119(+)] IV. ltIs38 [pie-1p::GFP::PH(PLC1delta1) + unc-119(+)]. Superficially wild-type. Maintain under normal conditions. Reference: Essex A, et al. Mol Biol Cell. 2009 Feb;20(4):1252-67. doi: 10.1091/mbc.e08-10-1047. Epub 2008 Dec 24. PMID: 19109417

ltSi264 [bub-1p::bub-1(re-encoded)::RFP + Cbr-unc-119(+)] II. BUB-1::RFP has been re-coded to be knl-1(RNAi) resistant. Reference: Pelisch F, et al. Mol Cell. 2017 Jan 5;65(1):66-77. doi: 10.1016/j.molcel.2016.11.001. PMID: 27939944

oqEx500 [tmem-107::GFP + unc-122p::DsRed]. Pick DsRed+ animals to maintain. TMEM-107::GFP accumulates in the ciliary transition zones of ciliated neurons. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.

F39B2.9/TMEM-107 has been shown to control the localization of 4 peripheral ciliary transition zone proteins. tmem-107(oq100); nphp-4(tm925) double mutants display ultra-structural malformations in ciliary transition zones, and exhibit sensory abnormalities including roaming, chemoattractant, and dye-filling defects. TRAM-1::tdTomato leaks into cilia in oq100 mutants. Genotyping primers: Forward cgcggttcttcttgtttctt, Reverse wildtype gagatcgagacggcgacg, Reverse oq100 gaaaaacaacgtggaagtcca. Reference: Lambacher NJ, et al. Nat Cell Biol. 2016 Jan;18(1):122-31.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx468 [ogt-1p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Over-expression of OGT-1 in presumptive null mutant ogt-1(dr20) background. gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx469 [dpy-7p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Hypodermal expression of OGT-1 rescues presumptive null allele ogt-1(dr20). gpdh-1p::GFP is induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx470 [nhx-2p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Intestinal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx471 [myo-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Muscle-specific expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. drEx472 [rab-3p::ogt-1(cDNA)::ogt-1 3'UTR + rol-6(su1006)]. Pick Rollers to maintain. Neuronal expression of OGT-1 provides tissue-specific rescue in ogt-1(dr20) presumptive null background. gpdh-1p::GFP is not induced during hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drEx206 [hsf-1p::hsf-1::YFP::unc-54 3'UTR + unc-119(+)]. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+) II. Human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules only after prolonged (1 hr) 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules after >1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi12 [hsf-1p::human hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy human HSF1 (drSi12) in hsf-1(sy441) hypomorph. drSi12 includes human hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the C. elegans hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy C. elegans HSF-1 (drSi13) in hsf-1(sy441) hypomorph. drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Exhibits nuclear GFP expression that redistributes into granules at a reduced rate compared to wild type immediately after 1 min 35C heat shock. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi13 [hsf-1p::hsf-1::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi13 in the background of balanced hsf-1(ok600). drSi13 includes hsf-1 cDNA with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP rescued ok600; drSi13 homozygotes, very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in hsf-1(sy441) hypomorph. drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain, with a C-terminal GFP and under control of 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Larval arrest at 25C. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi28 [hsf-1p::hsf-1(R145A)::GFP::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi28 in the background of balanced hsf-1(ok600). drSi28 includes hsf-1 cDNA containing an arginine to alanine mutation at residue 145 in the DNA binding domain with a C-terminal GFP and controlled by 4 kb of the hsf-1 promoter, integrated at a single copy by MosSCI on chromosome II at ttTi5605. Segregates WT GFP+ heterozygotes, non-GFP ok600 homozygotes (not rescued by drSi28), very rare GFP+ homozygous hT2, and dead eggs. Maintain by picking wild-type GFP+. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605 in EG4322. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drSi41 [hsf-1p::hsf-1::HA::unc-54 3'UTR + Cbr-unc-119(+)] II. Expresses single-copy drSi41 in hsf-1(sy441) hypomorph. drSi41 includes hsf-1 cDNA containing an HA tag in frame between amino acids 370 and 371, under control of 4 kb of the hsf-1 promoter, integrated as a single copy by MosSCI on chromosome II at ttTi5605. Moderate rescue of sy441 25C growth arrest, but should be maintained at 20C or lower. Reference: Morton EA, Lamitina T. Aging Cell. 2012 Oct 26. doi: 10.1111/acel.12024.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. ogt-1(dr20) was isolated in an ENU screen in parental strain OG119 for mutants with decreased induction of the gpdh-1p::GFP reporter during hypertonic stress. dr20 is a presumptive null allele [Q600STOP]. OG969 has decreased gpdh-1p::GFP induction during hypertonic stress and impaired adaptation to hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

drIs4 [gpdh-1p::GFP + col-12p::DsRed] IV. ogt-1(dr20) was isolated in an ENU screen in parental strain OG119 for mutants with decreased induction of the gpdh-1p::GFP reporter during hypertonic stress. dr15 is a presumptive null allele [R267STOP]. OG971 has decreased gpdh-1p::GFP induction during hypertonic stress and impaired adaptation to hypertonic stress. Constitutive col-12p::DsRed expression. Reference: Urso SJ, et al. (2020). The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. bioRxiv, 2020.2005.2001.072033.

otIs323 [cho-1p(SL2 bicistronic)::2xNLS::GFP + elt-2::DsRed2]. Fosmid-based reporter labels virtually all cholinergic neurons. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

ccIs4251 [(pSAK2) myo-3p::GFP::LacZ::NLS + (pSAK4) myo-3p::mitochondrial GFP + dpy-20(+)] I. otIs77 [ttx-3p::kal-1 + unc-122p::GFP] II. ruIs37 [myo-2p::GFP + unc-119(+)] III. jcIs1 [ajm-1::GFP + unc-29(+) + rol-6(su1006)] IV. vsIs33 [dop-3::RFP] V. ajm-1 was formerly known as jam-1 (Junction Associated Protein) and "the gene encoding the antigen recognized by the monoclonal antibody MH27." jcIs1 consists of pJS191, C45D3 and pRF4. Reference: Koppen M, et al. Nat Cell Biol. 2001 Nov;3(11):983-91.

otEx4441 [hsp-16.2p::unc-3(cDNA) + ttx-3::mCherry]. vsIs48 [unc-17::GFP]. GFP expressed in all cholinergic neurons. Maintain by picking mCherry(+) animals. Reference: Kratsios P, et al. Nat Neurosci. 2011 Nov 27. doi: 10.1038/nn.2989.

otIs376 [eat-4(prom4)::GFP + rol-6(su1006)]. Rollers. Reference: Serrano-Saiz E, et al. Cell 2013. Oct; 155(3):659-73.

otEx5024 [lsy-6(fosmid) + ttx-3::mCherry]. Maintain otEx5024 by picking animals with mCherry in the AIY neurons. otIs3 [gcy-7p::GFP + lin-15(+)] V. Integrated from adEx1288; genetically mapped between 3.05 m.u. (T19B10) and 5.86 m.u. (AH10) on V. GFP expression appears in ASEL and the excretory cell in adult animals.