Search Strains

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain.. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7147 and CGC63. hd7147 is a 7691 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCAATTCTTCAATTTTTCCAATTCTTC; Right flanking sequence: TCTTTTCTGGTCGACAAAGGTGCCTAAATC. sgRNA #1: ATAAAGTGAAGATTGGTGGG; sgRNA #2: AACAGTGTTTTGGGGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 885 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGAGTTCAAAGGCAAGCACATTGGCGCGGC; Right flanking sequence: TGGAATATATTATTCAAAAACGACAATTGC. sgRNA #1: GACCGCCCGTCTCGAGACAT; sgRNA #2: TTCAGAATGAGTTCAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1991 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TACGATGGAACCATCACCAGACGGTCAACT; Right flanking sequence: TTTTCTCATTTTTCTCATCGTCGATGCATT. sgRNA #1: CGAGATAATCGCAAATTCAG; sgRNA #2: CCACATATGTTATCAAATGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3115 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAGTGGACGGTTTTGTGGGCATAATGCAT; Right flanking sequence: CCACTCCCCTTTTTCGGAAATTGGAAAACG. sgRNA #1: CACATTTCACGCACAGAAGA; sgRNA #2: TGAACGAAAGATTAACGGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1790 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAGGCCTCCAGTAGATGCTCCAGGAGCCG; Right flanking sequence: CGGGATGCGATACACGAAAACCTTGGGTTT. sgRNA #1: TGCAGTTTCCCGCCCTCGTC; sgRNA #2: TGACCGCTGGTTCCGATCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAACTGTGGATAGAATTAGGGGTGGACGAA; Right flanking sequence: AATATAGTATTATAGGACCGAAAATATAGA. sgRNA #1: AAACGATTTACTCCGGCTAT; sgRNA #2: CAAAAAATTAGCGTCTTCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCAACTTCTGGACAACCGGCAGAAACGCCA; Right flanking sequence: GTAGGCACAAAGAAGGCGTAGGCCTCCTGG. sgRNA #1: TGGCGTTTCAGAGCTGCACG; sgRNA #2: AAAGCCAATTGTCTGAAAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 969 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAGACCTTGAACAATCTTCCATTCGCCA; Right flanking sequence: CGGACATTCTGAAAATTTAGCAATTTACAC. sgRNA #1: TTCCCAGTTACCATCGAGGG; sgRNA #2: GACCAAAACGCGAAGTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2415 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACTTTCTCGGAGTTATCCCCTTCGATTT; Right flanking sequence: GGGAGAGGAGTAGGTCCCGGTGGTAAATTT. sgRNA #1: GTCGAGCGATGGAAGACCGG; sgRNA #2: GGAGAGTATTGCCGAACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 911 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAAATGTTGAAAATAAAAGTGAAAAACTCT; Right flanking sequence: TGGAATTGGATATTTTTGCCACTTTTAATC. sgRNA #1: GTTGGTGTGGTTTTGCGTGG; sgRNA #2: TTTCTCTCCCGTAAACCACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7170 and CGC63. hd7170 is a 966 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CAGAAAGAGCCTTCTCGACACGATTTTCCG; Right flanking sequence: TTCGAAAGTGGCAATCAGGAACTCTAACGA. sgRNA #1: AATGGTTACCTGCTGCGACG; sgRNA #2: GGTTGGGCAATACTCTCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6488 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAAAGCCGAGATTACAAAGAATATGATGA; Right flanking sequence: GACCTTTTATAACTATTCACCCATACTAAT. sgRNA #1: AAGACGAGTCGGCACAGTTG; sgRNA #2: GTGAAGTTGTTATTGTACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2058 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTAAAAACTTTAATAGATACATTTTTGGC; Right flanking sequence: ATACGCTTCTACAATACAACAATCGTTGAA. sgRNA #1: AAAATTACGCCAAACCTGCT; sgRNA #2: ACATTTGAATTATGTTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 512 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTACTTTCAGGCCCAAATGTGGAAATTGCG; Right flanking sequence: ACTATATGTGACATTTTGAAGAAGTAATAT. sgRNA #1: GCCTCAAGTACAAGCCTACT; sgRNA #2: TGAATAGTTGATTGGCACCA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCTGTGCAGATCCAACTAGGGCGTCTCCA; Right flanking sequence: AGGAAATTTTTGTCGAAAATTCTGAAAAAT. sgRNA #1: CATGGTATGGATGGAAGCAT; sgRNA #2: CAAAGTTAGCAATTTTGGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7175 and CGC63. hd7175 is a 1325 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCAAAAAATCAATATCTTCACCATTTTCA; Right flanking sequence: TGGAGCTACAAAATTCGCCGATTTTGAAAA. sgRNA #1: GACTTTCCTACGCAACACCA; sgRNA #2: ATTCTCTTCGCAGATGCCGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7177 and CGC92. hd7177 is a 7087 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GATGGTCCATTTGTATTAGTTGTTGTACCA; Right flanking sequence: TTTTAGTTGGAACGGCTCGCGCCCAAGCAG. sgRNA #1: CTTGGCTGTGATGATTGACC; sgRNA #2: AAACGGAACAAGGACACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile wild-type GFP+. Apparent homozygous lethal or sterile deletion balanced with hln1. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ homozygotes, and Unc homozygotes. Derived from parental strains VH7178 and PS1056. hd7179 is a deletion of 12118 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTCGGGCGAGGTAACGGGCGAATATTGCCG; Right flanking sequence: AACTGATTCTCAGTTAACCTAACCAATGAT. sgRNA #1: CAAACCCCGTACTTTTCAGG; sgRNA #2: AAGAAGTCGGGCTACTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs37 [myo-2p::mKate2 + NeoR, II: 11755713 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mnC1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ homozygotes and paralysed DpyUnc mKate2+ mnC1 homozygotes. Derived from parental strains VH7182 and CGC48. hd7182 is a 1757 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCACAACTCTGTGGAATATCCATTTCAC; Right flanking sequence: ATAGCTTCTTCGCTTATTTTTCCAGACATC. sgRNA #1: ACGCTCGAATCGCAAACTGG; sgRNA #2: GCAGGAACAGGCCGAAAGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4597 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGCACCTGTCACTTGACACTCCTTTGTCCA; Right flanking sequence: TTTAAGCCTCAAAATTGTCATGCTAAAAAA. sgRNA #1: CTGGGAAGTGAGCAGTCTAC; sgRNA #2: CCGGGATAAGAAGGTACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 952 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTAATCGCCCAAATTCCAAAAATTATGCCA; Right flanking sequence: AGGAGAGCAGCTCGGGTGTACGCTGTAGCT. sgRNA #1: ATTGTGGTTGCTACTCTTTT; sgRNA #2: AGGCAAGAAATCTTCCAACT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTGTCATTTCTCATCACTGACCACAATTGC; Right flanking sequence: TGGTGAATATTACCAATGAATGGAAGAGGT. sgRNA #1: GCAAAAACTAATGAACCAGC; sgRNA #2: GGTTTGTCCAGTGGCATAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7195 and CGC63. hd7195 is a 2300 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AAACTCTTTTTCCACCCGGAAAGCATTCCA; Right flanking sequence: AAAATATTGAATTTAAATATTTAAATGTTA. sgRNA #1: GAAGAACAACAAGGACTTAC; sgRNA #2: CAGGGAAATGACAAACGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal non-GFP mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Derived from parental strains VH7196 and CGC92. hd7196 is a 1856 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TACGCTAATGCAAAGATCTACAGATGTTCT; Right flanking sequence: AGGAAGAGTTACTGCTGTGAAGGGAGACGC. sgRNA #1: AACCAAGAGTGCCCAAGGCC; sgRNA #2: ATTGGATCGTTGTCAACGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1578 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACACTGCCGGTTTTGCACGGAAATGTGCCA; Right flanking sequence: TACCAACGATTCTCTTTCAGTTTTAAATTT. sgRNA #1: CTTCGGAGATACAGAGCACG; sgRNA #2: TTTTGTAATAGGCACTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1318 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGACCTGCTTAGATTATTAATAGAATACT; Right flanking sequence: TGGATTTTCATAGTCTTGGAACTCGTGAAT. sgRNA #1: TTCCAAAGCGAAGATCAAAT; sgRNA #2: TCTCCCAATTTCAACAGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTGTTTTGCAACATACCGAAACTAGAGTA; Right flanking sequence: ACCACGTTTTCACTCAAAGCCCACCCTCCT. sgRNA #1: CACATTCCAATAATACCTCG; sgRNA #2: CATCCAGCTGATGCTTTGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1080 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTAATTTGAAGTTTTCCATTAATTCCA; Right flanking sequence: GGGTTTTTCTTCGCAAGATTCACGTTTCGG. sgRNA #1: GCTTCATAAATGCATATTCC; sgRNA #2: TTTAATGATACTTTTAGGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with tmC6. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and Dpy mCherry+ homozygotes. Derived from parental strains VH204 and FX30138. hd7204 is a deletion of 3569 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGAACACCAGGCGACTGTATTGAACATTTG; Right flanking sequence: GAATGTCCGAATTTCTCGGTTTTTGCGTAT. sgRNA #1: GATTGATAGGCAGACTCCGG; sgRNA #2: GATGATGGATGTCGGAGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and Broad, nuclear red fluorescence. pCFJ453 inserted into unc-119(ed3) III+. Apparent homozygous lethal or sterile deletion stabilized over oxTi731. Heterozygotes are wild-type GFP+ and tdTomato+ and segregate wild-type hereozygotes (GFP+ tdTomato+), hd7198 homozygotes (GFP+), oxTi731 homozygotes (tdTomato+), and occasional hd7198 oxTi731 recombinants. Derived from parental strains VH7198 and EG7887. hd7198 is a deletion of 1473 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AAACCCGCCAAATTCATCAAACAATTCCCG; Right flanking sequence: CGGCGACTACATTGATACTACGAGAAATTG. sgRNA #1: CATAAAAACCGAGGAGCCGG; sgRNA #2: CGAAACTACGAGGCTCCGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7202 and CGC63. hd7202 is a 541 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTAAAAACAATGGTTCAAGGAAAGCTCAAG; Right flanking sequence: TTGATGCTCTTTTGTTACGAACTTTATACC. sgRNA #1: CAAAAGACAGCCTTGCCAAA; sgRNA #2: AAAAGTGATTTCGTAGGCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 670 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAAAAAACGATAAAAAATGCTTATAAAAT; Right flanking sequence: AGGTGATCGCAGTGCCAACGAGTGTAGCAG. sgRNA #1: ATTATTTTCAGACGCTGTCC; sgRNA #2: CCGCGAAGAGAAGCAATTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced over nT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Vul mKate2+ (nT1) and dead eggs. Derived from parental strains VH7205 and CGC63. hd7205 is a 672 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: GACTCGAACTCAATTTGCATGTTGATAGTT; Right flanking sequence: TGGTTAGAAAAAGATACGGAGAGGAGAAGT. sgRNA #1: CCAATGTTAAAGAAAGTCTT; sgRNA #2: AAACTCTCTTATAGCACAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Maintain by picking viable fertile GFP+ and mCherry+. Apparent homozygous lethal or sterile deletion balanced with FX30266. Heterozygotes are wild-type GFP+ and mCherry and segregate wild-type GFP+ mCherry, GFP+ homozygotes, and tmIs1226 mCherry+ homozygotes. Derived from parental strains VH7179 and FX30266. hd7179 is a deletion of 1609 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGACATTGCACACCGGACGATGAATCTCCA; Right flanking sequence: TGGAATATCCATCACCTGTAGAAATAAAAA. sgRNA #1: GGCAAAAGCTTTCCAAAACG; sgRNA #2: TCGAAAACTCGCCGTGCCGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

pmcIs1 [ant-1.1p::ant-1.1::GFP + unc-119(+)]. Expression of ant-1.1::GFP under ant-1.1 promotor (Farina et al., Dev Dyn 2008) in most tissues including the gonads and in the spermatozoa. GFP intensity is low and unstable. GFP positive worms should be selected under fluorescence microscope. ant-1.1::GFP expression seems to be more stable when worms are grown at 24°C and in the dark. Reference: Al Rawi S, et al. Science. 2011 Nov 25;334(6059):1144-7.

Superficially wild-type. Hypersensitive to selenium-induced motility impairment, but not lethality. Reference: Morgan KL, et al., Toxicol Sci. 2010 Dec;118(2):530-43.

neEx15 [myo-2::RFP + myo-2::avr-15(+) + unc-119(+)]. MosSCI recipient strain. neEx15 rescues unc-119, making the worms healthier for injection. The array is counter-selectable. Reference: Shirayama M, et al. Cell. 2012 Jul 6;150(1):65-77.

qaIs8400 [let-858p::Ov-GST-3 + rol-6(su1006)]. Called AK1 in the reference article. The Ov-GST-3 gene was amplified from genomic DNA of O. volvulus with 1µM of the sequence specific primer 5'Klon and 3'Klon (5'Klon: 5'-GGCGTACGATGTCAAGATTTCCTCAACAAG-3'; 3'Klon: 5'-GGTCTAGATTTATTTAGGAATGATTGAATCGGTCG-3'; representing bases 4 - 25 and the complementary sequence of bases 821 - 841 of the published Ov-GST-3 cDNA (AF203814); bold underlines indicate restriction sites for Pfl23II (SplI) and XbaI, respectively; dotted underline indicates the start codon for translation; italics indicates the conserved sequence for the polyadenylation signal for transgenic transcript processing; the 8 5'-nucleotides of primer 3'Klon and the fourteen 5'-nucleotides of primer 5'Klon do not correspond to the template and introduce the sequences to the amplicon), 200 µM of each deoxynucleotide (Gibco BRL) and 2.5 units of Taq polymerase (Gibco BRL). After an initial denaturation of 3 minutes at 93°C, 35 cycles of annealing at 55°C for 1 minute, synthesis at 72°C for 2 minutes and a 1 minute denaturation at 93°C were performed, followed by a final extension at 72°C for 5 minutes. The genomic Ov-GST-3 fragment obtained by PCR (see above) was ligated into the pGEM-T Easy vector (Promega) by TA-cloning, cleaved with the restriction enzymes Pfl23II (SplI) and XbaI (restriction sites introduced by the primer) and inserted between the unique Pfl23II (SplI) and XbaI sites of the vector pPD103.05 (kindly provided by A. Fire). The sequence of the genomic Ov-GST-3 fragment in the resulting plasmid pAK1 was confirmed by automated dye terminator, dideoxy sequencing (ABI Prism 377TM Sequencer, PE Applied Biosystems) using the PCR primers (see above). The pAK1 DNA was injected in combination with the marker plasmid pRF4 [rol-6(su1006)] into the gonads of N2 C. elegans at a concentration of approximately 100 ng/µl for each plasmid. Transgenic worms were identified by the selectable Roller marker phenotype and the stable transmitting line AK1ex (AK1 extrachromosomal) was established. Integration of the extrachromosomal arrays was achieved by irradiation of AK1ex worms with 3600 rad (1 rad = 0.01 Gy) of x-rays (x-ray chamber: RUM 9421-070-77002, Philips, Netherlands; dosimeter: PTW-SN4, PTW, Germany). The progeny of these worms was then screened for 100% transmittance of the Roller phenotype to obtain the C. elegans line AK1int (AK1 integrated) with the chromosomally integrated transgenes.

wpEx505 [ocr-3p::mEGFP + pha-1(+)]. Maintain at 23-25C to select for array. PVP neurons are marked with mEGFP. Can be used to isolate PVP by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/). The ocr-3p::mEGFP plasmid used to generate this strain was provided by Dr. Patrick Laurent.

wpEx517 [srab-20p::Neptune2.5 + pha-1(+)]. Maintain at 25C to select for animals carrying the array. Neptune2.5 expression in PHB neuron can be used to isolate PHB by FACS. Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

otIs707 [bnc-1p(1.8kb)::GFP]. wpEx525 [nlp-38p::NLS::TagRFP + pha-1(+)]. Maintain at 25C to select for animals carrying the array. GFP expression in VA neurons can be used to isolate VA by FACS (exclude TagRFP). Used by CeNGEN project for RNA-Seq (https://www.cengen.org/).

Point mutation C133Y. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(d)-induced neurodegeneration. Bent-head.

Point mutation in G102E. No easily detected phenotype, selected for suppression of mec-4(d)-induced degeneration caused by ectopic expression of mec-4(u231) in the ventral nerve cord. Bent-head.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4340 [nmr-1p::TeTx::wCherry + sra-11p::TeTx::wCherry + HygromycinR]. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Transgenic animals are severely Unc. RFP positive head neuron soma can be observed under V16 in older animals. Hygromycin can be used to select for hpEx4340 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

ljIs131 [myo-3p::GCaMP3::UrSL2::tagRFP-T]. hpEx4343 [acr-5p::TeTx::wCherry + unc-4p::TeTx::wCherry + HygromycinR]. Pick animals with wCherry expression in ventral cord neurons to maintain hpEx4343. Animals carrying the array show additional red fluorescence in the head compared to those that have lost the array. Animals carrying hpEx4343 rest as coilers strongly biased towards ventral bend as L1 larvae and are severely Unc as adults. Coiling is somewhat suppressed in the ljIs131 background, but animals still exhibit an obvious bias towards ventral bend during movement. Hygromycin can be used to select for hpEx4343 transgenic animals. Reference: Lu Y, et al. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. PMID: 36182701.

hpIs814 [flp-18p::LoxP::eBFP::Stop::LoxP::TeTx::wCherry + twk-40p(short)::Cre]. Red fluorescence in AVA. twk-40(hp834) is a loss-of-function allele. twk-40(hp834) itself is highly loopy and a weak backward coiler. The presence of hpIs814 in the background reduces body bending and speed compared to twk-40(hp834) alone.