Strain Information
Name | VH7163 View On Wormbase Documentation for VH7163_hd7157_ula-1 |
---|---|
Species | C. elegans |
Genotype | +/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ula-1(hd7157 [loxP + myo-2p::GFP::unc-54 3’ UTR + rps-27p::neoR::unc-54 3’ UTR + loxP]) III. |
Description | umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. |
Mutagen | Crispr/Cas9 |
Outcrossed | x0 |
Made by | VH KO group |
Laboratory | VH |
Reference | n/a |
Sign in
or
register an account if you want to order this strain.