More Fields
Strain Species Genotype
IC683 C. elegans npr-9(tm1652) X. Show Description
IC765 C. elegans npr-9(tm1652) X; quEx182. Show Description
quEx182 [npr-9(+) + sur-5::GFP + odr-1::RFP]. Maintain by picking GFP+. Rescuing npr genomic fragment co-injected with sur-5::GFP and odr-1::RFP]. transgenic (GFP+) animals tend to wander off the food.
IC611 C. elegans quEx128. Show Description
quEx128 [npr-9::GFP + rol-6(su1006)]. Maintain by picking Rollers. ZK455.3 is npr-9 and is expressed in AIB neuron.
OH13918 C. elegans otIs643 V. Show Description
otIs643 [npr-9p::TagRFP + rol-6(su1006)] V. Transgene contains 1.7 kb npr-9 promoter fragment. Spontaneous integration of otEx6471.
OH16940 C. elegans ceh-20(ok541) III; otIs643 V; muEx261. Show Description
otIs643 [npr-9::TagRFP + rol-6(su1006)] V. muEx261 [ceh-20::GFP + odr-1::RFP]. Pick RFP+ animals to maintain. Rollers.
PS8586 C. elegans npr-9(sy1417) X. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of npr-9. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: GTCATCATTGCCTCTTCAGTAAATACACGTTCACC right flanking sequence: CATAGgtgtataattgaacttatgtatatgttttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GTAAATACACGTTCACCCAT Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
TQ2183 C. elegans lite-1(xu7) X; xuEx705. Show Description
xuEx705 [npr-9p::GCaMP3.0 + npr-9::DsRed2B]. Superficially wild-type. Maintain by picking red fluorescent animals; DsRed might not be visible at lower magnifications. Reference: Piggott BJ, et al. Cell. 2011 Nov 11;147(4):922-33.
JN578 C. elegans peIs578. Show Description
peIs578 [npr-9p::casp1 + npr-9p::Venus + unc-122p::mCherry]. AIB neurons are ablated by specific expression of caspase. Reference: Kunitomo H, et al., 2013, Nat Commun. 2013;4:2210. doi: 10.1038/ncomms3210.
OH14529 C. elegans otTi19. Show Description
otTi19 [npr-9p::inx-6::GFP]. Mos-mediated insertion. Reference: Bhattacharya A, et al. Cell. 2019 Feb 21;176(5):1174-1189.e16.
SRS278 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx278. Show Description
sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.
SRS291 C. elegans pha-1(e2123) III; lite-1(ce314) X; sraEx291. Show Description
sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.