| VC890 |
C. elegans |
+/mT1 II; tag-307(gk418)/mT1 [dpy-10(e128)] III. Show Description
ZK652.10. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk418 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC906 |
C. elegans |
zyx-1(gk442)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
F42G4.3a. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and gk442 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC937 |
C. elegans |
sop-2(ok1415)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C50E10.4. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1415 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC945 |
C. elegans |
tag-297(ok1336)/mT1 II; +/mT1 [dpy-10(e128)] III. Show Description
C38C6.6. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1336 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC971 |
C. elegans |
+/mT1 II; act-5(ok1397)/mT1 [dpy-10(e128)] III. Show Description
T25C8.2. Apparent homozygous lethal deletion chromosome balanced by dpy-10-marked translocation. Heterozygotes are WT, and segregate WT, arrested mT1 aneuploids, sterile Dpys (mT1 homozygotes), and ok1397 homozygotes (arrest stage/phenotype undetermined; may be sterile adult). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VH7090 |
C. elegans |
+/mT1 [umnIs52] II; vps-22(hd7082 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7082 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7082 and CGC66. hd7082 is a 525 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7106 |
C. elegans |
+/mT1 [umnIs52] II; mrps-23(hd7087 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7087 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7087 and CGC66. hd7087 is a 442 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7107 |
C. elegans |
+/mT1 [umnIs52] II; nars-2 (hd7098 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7098 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7098 and CGC66. hd7098 is a 5984 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7110 |
C. elegans |
F54C9.9(hd7083 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7083 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7083 and CGC66. hd7083 is a 1871 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7111 |
C. elegans |
exos-8(hd7091 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7091 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7091 and CGC66. hd7091 is a 5126 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7117 |
C. elegans |
ndub-3(hd7109 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7109 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7109 and CGC66. hd7109 is a 472 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7122 |
C. elegans |
+/mT1 [umnIs52] II; C34E10.10.1(hd7100 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7100 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7100 and CGC66. hd7100 is a 572 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7123 |
C. elegans |
enol-1(hd7101 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP])/mT1 [umnIs52] II; +/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion as balanced heterozygote. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7101 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7101 and CGC66. hd7101 is a 1562 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7130 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ tsen-2(hd7124 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7124 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7124 and CGC66. hd7124 is a 3032 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: CTATCAATGCTTTTTTATTGTGTGACAAGA; Right flanking sequence: CGCGAAAAATTCCAGGTTTTTTCCCATTTT. sgRNA #1: TTCGCGTGAGAGTTAGAAGC; sgRNA #2: CTCCATTGACAATCGTCTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7131 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ Y66D12A.7(hd7125 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 (hd7125 homozygotes), sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7125 and CGC66. hd7125 is a 1024 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ATCACATTCAAATCGAATCGTTCCTTCGAC; Right flanking sequence: TCCTTCTCCAAATCTTCTTATTATCCGTGT. sgRNA #1: TCGAGCGGCAGATTTCCCGG; sgRNA #2: AAACGAAAAACGCCATTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7132 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ZK632.14(hd7127 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7127 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACAGTACTCTTTAAAGGCTCTCAATCTTGT; Right flanking sequence: TGGAAAAGCAGACAAAAAAGGCGAGAAGAA. sgRNA #1: CATTCTACAAAAATGTATCG; sgRNA #2: GTGATTCGTACCTCACATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7133 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/tpk-1(hd7129 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7127 and CGC66. hd7101 is a 1043 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTTTGCCTCAGAGTAATAATAAGCTAAACA; Right flanking sequence: GGGATTCAAATCTTGATGTCAATCTTGAAA. sgRNA #1: TTTTAACCCCTCATCACAAG; sgRNA #2: CATTAAGAGTTAAATTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7163 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ula-1(hd7157 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7157 and CGC66. hd7157 is a 1439 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: AATTTGATAATCTCTTGAGCAGCTATTCCA; Right flanking sequence: GTTGGTGGCTGACTACTTGCACTACCAGAG. sgRNA #1: CCGACGTACGATGAAATGAC; sgRNA #2: CATCTTCCATAGCTAACGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7188 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ lmbr-1(hd7180 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7180 and CGC66. hd7180 is a 1876 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TTGCTTTTTACAGATTTAATAACACCAAAT; Right flanking sequence: TGGCTACAAATACCTTGAAATTGTTATTCG. sgRNA #1: GGCCCAATACGCCCTGGAGG; sgRNA #2: GACATGCTCTCTAATCATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| VH7191 |
C. elegans |
+/mT1 [umnIs52] II; mT1 [dpy-10(e128)]/ ZK632.4(hd7181 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-27p::neoR::unc-54 3 UTR + loxP]) III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Pick viable fertile GFP+ and mKate2+ animals to maintain. Apparent homozygous lethal or sterile deletion balanced with mT1. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile Dpy non-GFP mKate2+ mT1 homozygotes, and large numbers of arrested aneuploid embryos. Derived from parental strains VH7181 and CGC66. hd7181 is a 1382 bp deletion with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ACTTCCTGCACCCAGAACTCATCAATTCCA; Right flanking sequence: AGCCATGCTAGAATTTCCTTTGGGTCCCCA. sgRNA #1: TCACTACTATTTACTCCACG; sgRNA #2: GGAAGTCTTGCATTAGATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| CGC11 |
C. elegans |
unc-5(e53)/nT1 [umnIs1] IV; dpy-11(e224)/nT1 V. Show Description
umnIs1 [eft-3p::GFP + HygroR, V:~2821000] V. umnIs1 GFP is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking GFP+ WT. Derived by insertion of GFP transgene into parental strain MT1000 using MosSCI.
|
|
| CGC13 |
C. elegans |
unc-5(e53)/nT1 [umnIs3] IV; dpy-11(e224)/nT1 V. Show Description
umnIs3 [eft-3p::NLS::tdTomato + HygroR, V:~2821000] IV. tdTomato is expressed at low levels, and might be difficult to see in heterozygotes. Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT with tdTomato expression. Derived by insertion of tdTomato transgene into parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC140 |
C. elegans |
goa-1(n499)/tmC20 [unc-14(tmIs1219) dpy-5(tm9715)] I. Show Description
This strain is difficult and time consuming to maintain. Gives relatively few heterozygotes. Homozygous lethal mutation balanced by Dpy- and myo-2p::Venus-marked inversion. Heterozygotes are paralyzed Unc and Egl with relatively dim pharyngeal GFP (Venus) expression. Heterozygotes segregate heterozygous non-Dpy GFP+ paralyzed Unc and Egl, non-GFP embryonic lethal (homozygous n499), and Dpy with brighter GFP+ (tmC20 homozygous). Remove Dpy from plate to prevent them from taking over. Heterozygotes tend to stack up in parallel clumps. Populations can be enriched by transferring these clumps to new plates and allowing Dpy (tmC20 homozygotes) to crawl out into bacterial lawn, and then picking away Dpy or transferring the clump of Hets to another plate. Derived by balancing n499 from parental strain MT1102 over tmC20 from FX30179.
|
|
| CGC33 |
C. elegans |
unc-5(e53)/nT1 [umnIs22] IV; dpy-11(e224)/nT1 V. Show Description
umnIs22 [myo-2p::GFP + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC39 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs28] V. Show Description
umnIs28 [myo-2p::GFP + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, DpyUnc, Vul GFP+ (nT1) and dead eggs. Maintain by picking wild-type GFP+. Derived by insertion of myo-2p::GFP transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC63 |
C. elegans |
unc-5(e53)/nT1 [umnIs49] IV; dpy-11(e224)/nT1 V. Show Description
umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| CGC71 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 [umnIs57] V. Show Description
umnIs57 [myo-2p::mKate2 + NeoR, IV: 12457861 (intergenic)] V. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, Vul mKate2+ (nT1) and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into nT1 balancer in parental strain MT1000 using CRISPR/Cas9.
|
|
| DLM17 |
C. elegans |
pha-1(e2123) III; sup-36(e2217) IV. Show Description
Superficially wild-type. sup-36 suppresses temperature-sensitive lethality of pha-1(e2123). Constructed by crossing GE24 and MT14541.
|
|
| EG4 |
C. elegans |
pbo-5(ox4) V. Show Description
Abnormal posterior body muscle contractions during defecation. Derived by single outcrossing of MT1733; allelic to n2303.
|
|
| ENL61 |
C. elegans |
mir-58.1(n4640) IV; dbl-1(nk3) V. Show Description
Small. Derived from MT15024 and NU3.
|
|
| GR1321 |
C. elegans |
tph-1(mg280) cam-1(vs166) II. Show Description
Slow pumping. Egg laying defective. Low frequency of dauer formation. Residual serotonin immunoreactivity, rare and very faint (<1% of NSMs) in most stages, but nearly 100% of CP neurons in adult males show faint to moderate serotonin immunoreactivity. Males mate quite well (E. Hare and C. Loer). Some phenotypic defects originally attributed to mg280 in this strain are likely due to vs166. vs166 is a large deletion (approx. 9.8kb) in the cam-1 gene; flanking sequences are: 5'-gctactggtaaataaggtaa-3' and 5'-atgcttttaaagtttatatt-3' (Edith Myers, personal commnication). See MT15434 for a strain carrying mg280 without the cam-1 mutation.
|
|
| KB10 |
C. elegans |
mir-67(n4899) III. Show Description
MT15982 mir-67(n4899) was outcrossed 6x to produce this strain. Deletion breakpoints are:GGGTGCCTAATGCAAA / AGTACACATTTATGAAT...GCGAGTTTAAAGCAACG / AGTAGCAGAAGGACCA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| KB11 |
C. elegans |
mir-83(n4638) IV. Show Description
MT15501 mir-83(n4638) was outcrossed 6x to produce this strain. Deletion breakpoints are:GTTGAGAATTCCTGTTGCAAT / TAAAACTGAAATTTCGATCTA...TTTTTAGAATTGAGAGCA / ACGAAAGAACAAAATAAGAGA.Do not distribute this strain; other labs should request it from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
|
|
| MLC1016 |
C. elegans |
nDf50 nDf49 II; lucIs20. Show Description
lucIs20 [mir-35p::mirtron-35 + myo-2::mCherry]. Position of integrated transgene unknown (not on X). mir-35 family mutant expressing a mirtron-version of mir-35. nDf50 nDf49 mutants are partially rescued by expression of mirtron-35 from integrated transgene; mild mir-35-related phenotypes are more severe at elevated temperatures. Strain is derived from injection into parental strain MT14533. Position of integrated transgene unknown (not on X). Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
| MLC903 |
C. elegans |
nDf67 mir-52(n4100) IV/nT1 [qIs51] (IV;V); nDf58 X, lucIs24. Show Description
lucIs24 [mir-52p::mirtron-51 + elt-2::dsRed + myo-2::mCherry]. Pick GFP+ animals to maintain balanced line. Balanced mir-51 family mutant expressing a mirtron-version of mir-51. Heterozygotes are wild-type with pharyngeal GFP signal, and segregate wild-type GFP, arrested nT1[qIs51] aneuploids, and non-GFP mir-51 family homozygous mutants. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. Non-GFP mir-51 family homozygous mutants rescued by mirtron-51 transgene are viable, but slow-growing and sick. Strain is derived from injection into parental strain MT17143. lucIs24 is a spontaneous integrant originating from a complex extra-chromosomal array, the genomic location of the transgene is unknown. Reference: Dexheimer, PJ, et al. Curr Biol. 2020. in press.
|
|
| MT1000 |
C. elegans |
unc-5(e53)/nT1 IV; dpy-11(e224)/nT1 V. Show Description
Heterozygotes are WT and segregate WT, DpyUnc, Vul and dead eggs. Maintain by picking WT.
|
|
| MT1001 |
C. elegans |
lin-1(e1777) IV. Show Description
Multivulva. Amber. No male mating. Not Null.
|
|
| MT1006 |
C. elegans |
lin-1(n431) IV. Show Description
Strong Muv.
|
|
| MT1007 |
C. elegans |
lin-24(n432) IV. Show Description
Semi-dominant. Adult hermaphrodite Vul.
|
|
| MT1035 |
C. elegans |
lin-12(n137n460) III. Show Description
WT at 25C. Muv and Egl at 15C.
|
|
| MT10362 |
C. elegans |
unc-3(n3366) X. Show Description
|
|
| MT10408 |
C. elegans |
lin-53(n833) I; unc-76(e911) V; lin-15A(n767) X; nEx998. Show Description
nEx998 [lin-53::GFP + unc-76(+)]. Pick non-Unc, non-Muv to maintain.
|
|
| MT10430 |
C. elegans |
lin-35(n745) I. Show Description
synMuv with n111.
|
|
| MT10480 |
C. elegans |
unc-3(n3413) X. Show Description
|
|
| MT105 |
C. elegans |
lin-2(n105) X. Show Description
Temperature sensitive vulvaless. Penetrance: 24% at 15C, 90% at 25C.
|
|
| MT10549 |
C. elegans |
tdc-1(n3421) II. Show Description
Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
|
|
| MT10591 |
C. elegans |
lin-8(n2731) II. Show Description
SynMuv. Reference: Andersen EC, et al. Genetics. 2008 Aug;179(4):2001-12. Harrison MM, et al. Genetics. 2007 May;176(1):255-71.
|
|
| MT106 |
C. elegans |
lin-7(n106) II. Show Description
Egl.
|
|
| MT10661 |
C. elegans |
tdc-1(n3420) II. Show Description
Forages while backing. Deletion in L-aromatic amino acid decarboxylase with homology to histidine decarboxylase. Reference: Alkema M, et al. Neuron. 2005 Apr 21;46(2):247-60.
|
|
| MT1067 |
C. elegans |
egl-31(n472) I. Show Description
Egg laying defective. Makes bags of worms. Backward Unc.
|
|