More Fields
Strain Species Genotype
BC10295 C. elegans dpy-5(e907) I; sEx10295. Show Description
sEx10295 [rCes ZC328.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
BC11353 C. elegans dpy-5(e907) I; sIs10295. Show Description
sIs10295 [rCesZC328.3::GFP + pCeh361]. Maintain by picking WT. WT animals are GFP+. Strain construction supported by Genome British Columbia and Genome Canada. Please acknowledge McKay et al, Cold Spring Harbor Symposia on Quantitative Biology 68: 159-169 2004 (WBPaper00006525).
CGC128 C. elegans +/hT2 [umnIs15] I; dcr-1(pk1351)/hT2 [bli-4(e937) let-?(h661)] III. Show Description
umnIs15 [myo-2p::GFP + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT GFP+ and segregate WT GFP+, dcr-1 homozygotes (protruding vulva, sterile/egl, rupture at vulva), lethal GFP+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional GFP+ Pvul. Pick WT GFP+ and check for correct segregation of progeny to maintain. Derived from parental strains CGC26 and NL687. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]
CHS1222 C. elegans f27e5.8(yum2341) t10g3.4(yum2342) t10g3.2(yum2343) y57g11c.46(yum2344) y57g11c.28(yum2345) II. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
CHS1262 C. elegans srt-42(yum2647) srt-43(yum2648) srt-44(yum2649) srt-45(yum2650) srt-47(yum2651) srt-48(yum2652) srt-49(yum2653) srt-50(yum2654) srt-52(yum2655) srt-53(yum2656) y57g11c.28(yum2657) y57g11c.30(yum2658) V. Show Description
Engineered null mutations in predicted GPCR genes. Reference: Pu L, et al. Nat Commun. 2023 Dec 18;14(1):8410. PMID: 38110404.
HW1870 C. elegans lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) I. Show Description
Pick GFP+ Egl to maintain. Segregates GFP- lin-41(xe8) homozygotes (die by vulval bursting as young adults), lin-41(xe8)/lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) heterozygotes (GFP+ Egl), and lin-41(bch28[eft-3p::gfp::h2b::tbb-2 3'UTR] xe70) (GFP+ Ste Dpy). lin-41(xe8) is a deletion of let-7 binding sites in the lin-41 3'UTR. The balancer was derived from lin-41(bch28), a lin-41(0) allele in which an expression cassette that drives ubiquitous nuclear GFP from the eft-3 promoter has been inserted into the lin-41 coding sequence (Katic et al., G3 (2015) 5:1649-56). References: Katic et al., G3 (2015) 5:1649-56 for lin-41(bch28) starting allele for balancer generation. Aeschimann F, et al. (2019). A single let-7 target to coordinate transition to adulthood. Life Science Alliance 2, e201900335. for balanced line. Do not distribute this strain; other labs should request it directly from the CGC. This strain cannot be distributed to commercial organizations. This strain cannot be used for any commercial purpose or for work on human subjects.
JC328 C. elegans flr-5(ut73) V. Show Description
Partially resistant to 400ug/ml NaF. Suppressor of the slow-growing phenotype of mutations in flr-1, flr-3, and flr-4.
MLC528 C. elegans lucSi28 II; henn-1(tm4477) III. Show Description
lucSi28 [myo-2p::HEN1::unc-54 3Â’UTR + Cbr-unc-119(+)] II. Superficially wild-type. Cell-type-specific 3'-terminal 2'-O-methylation of animal miRNAs by a genetically encoded plant-specific methyltransferase (Arabidopsis thaliana HEN1). NOTE: This strain might still carry unc-119(ed3) in the background. Reference: Alberti C, et al. Nat Methods. 2018 Feb 26. doi: 10.1038/nmeth.4610.
OP735 C. elegans unc-119(tm4063) III; wgIs735. Show Description
wgIs735 [ZC328.2::TY1::EGFP::3xFLAG + unc-119(+)]. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Expression of transgene confirmed by GFP. References: Sarov M, et al. Nat Methods (2006) 10:839-44. Zhong, M, et al. PLoS Genet (2010) 6(2):e1000848. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org).
PS8725 C. elegans lgc-28(sy1490) II. Show Description
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of lgc-28. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CAGCTTAAATATTCAACTGGAACCTTCTCCTGGCG right flanking sequence: AGATGGAGAAAAGATATGAAGCTGAGgtatgtttttc inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: GGAACCTTCTCCTGGCGAGA Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
QC128 C. elegans paqr-1(tm3262) IV. Show Description
Superficially wild-type. paqr-1(tm3262) have an increased number of small lipid droplets when combined with paqr-2(tm3410) in double mutants. Reference: Svensson E, et al. PLoS One. 2011;6(6):e21343.
RB1391 C. elegans san-1(ok1580) I. Show Description
ZC328.4 Homozygous. Outer Left Sequence: cgcaaatttttgctgtcttg. Outer Right Sequence: tggattctgcatggatttca. Inner Left Sequence: ggcgtggagaaagctacaac. Inner Right Sequence: ttcagctgccaattgttttg. Inner Primer PCR Length: 2133. Estimated Deletion Size: about 1000 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
RB2508 C. elegans ZC328.3(ok3471) I. Show Description
ZC328.3 Homozygous. Outer Left Sequence: caattggcagctgaacttga. Outer Right Sequence: agttccatttctccacgcac. Inner Left Sequence: tgaaatccatgcagaatcca. Inner Right Sequence: gcttctactttgaaaaataacaacga. Inner Primer PCR Length: 1164. Estimated Deletion Size: about 700 bp. Attribution: This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
TG3969 C. elegans san-1(ok1580) I. Show Description
ZC328.4. IR sensitive. External left primer: AACAAGAAGGGGAAGAAAGA. External right primer: TGTCTCATCGAAATCCAACT. Internal Left Sequence: AGGAAGAAACGAGAAAAGCA. External WT amplicon: 1420 bp. External mutant amplicon: 428 bp. Internal WT amplicon: 720 bp. Reference: Bertolini S, et al. G3 (Bethesda). 2017 Dec 4;7(12):3875-3885.
UP233 C. elegans eor-1(cs28) IV. Show Description
Deletion allele. Mildly Unc, low percentage larval lethal, low percentage Egl.
VC128 C. elegans mtl-2(gk125) V. Show Description
T08G5.10. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC228 C. elegans nlg-1(ok259) X. Show Description
C40C9.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC328 C. elegans mir-47(gk167) X. Show Description
K02B9.5. Superficially wild type. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC428 C. elegans unc-63(gk234) I. Show Description
Y110A7A.3. Unc. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC528 C. elegans eya-1(ok654)/hIn1 [unc-101(sy241)] I. Show Description
C49A1.4. Deletion balanced by unc-101-marked inversion. Heterozygotes are WT and segregate WT, Unc-101 hIn1 homozygotes, and ok654 homozygotes (arrest stage/phenotype undetermined). Pick WT and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
VC828 C. elegans unc-94(ok1210) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C06A5.7a. Homozygous sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ok1210 homozygotes (grotty sterile). Homozygous hT2[bli-4 let-? qIs48] inviable. Note: qIs48 has been observed to recombine off hT2, typically leaving behind a functional homozygous viable hT2 with Bli-4 phenotype. Pick WT GFP and check for correct segregation of progeny to maintain. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807