| KR3627 |
C. elegans |
unc-46(e177) mdf-1(gk2) V/nT1 [let-?(m435)] (IV;V). Show Description
C50F4.11. Strain segregates WT, Uncs (give Sterile progeny or progeny with reduced brood size, all of which arrest before hatching (24%), at various stages of larval development (55%), or later) and dead eggs. Rec'd new stock 11/2002. Attribution: Paper_evidence WBPaper00005604
|
|
| KRA867 |
C. elegans |
tol-1(syb8406[3xLinker::WrmScarlet::linker::3xFLAG]) I; lat-1(syb8408[lat-1(before 651 aa)aaaaA::EGFP::linker::3xFLAG::aaaaA]) II. Show Description
syb8406 is WrmScarlet and 3xFlag tags inserted into endogenous tol-1 locus. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
|
|
| LWA1031 |
C. elegans |
wleSi1852 I; wleSi1565 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1565 [unc-54p::DanRS_rpr-1::tRNA(CUA)Leu + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1560 |
C. elegans |
wleSi151 II. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1564 |
C. elegans |
wleSi151 II; wleEx35. Show Description
wleSi151 [unc54p::mCherryTAG156 + Cbr-unc-119(+)] II. wleEx35 [unc-54p::DanRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP]. Pick animals expressing GFP in their pharynx to maintain wleEx35. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the mCherry reporter is dependent upon expression of temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1582 |
C. elegans |
wleSi1582 I. Show Description
wleSi1582 [unc-54p::JFF_luciferaseTAG185 + Cbr-unc-119(+)] I. It is likely that unc-119(ed3) remains in the background. Superficially wild-type. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Expression of the Japanese firefly luciferase reporter can be detected using standard luciferase assays. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| LWA1852 |
C. elegans |
wleSi1852 I; wleSi1853 X. Show Description
wleSi1852 [unc-54p::luciferaseTAG185 + Cbr-unc-119(+)] I. wlels1853 [unc-54p::OmeRS_rpr-1::tRNA(CUA)Tyr + myo-2p::GFP] X. It is likely that unc-119(ed3) remains in the background. Animals are slightly sick. All animals should express GFP in their pharynx. Expression of the luciferase reporter is dependent upon temperature-sensitive suppression of premature amber stop codon. Strain may be raised at 20C, but should be raised at 15C for several generations before assaying reporter expression. Reference: Parrish AR, et al. ACS Chem Biol. 2012 Jul 20;7(7):1292-302.
|
|
| MSB486 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirEx131. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirEx131 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Maintain by picking worms with YFP expression in AIB neurons. Blue fluorescence in flp-18 expressing neurons. loxP sites inserrted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. mirEx131 contains calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB and gpa-14p:CRE. CRE under gpa-14 promoter generates a conditional eat-4 KO in ASH (NOT defective) after recombination of loxP sites in that locus and switches BFP expression in AVA to ChR2-HRDC and jRGECO1a after recombination of lox2272 sites. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB609 |
C. elegans |
mirSi16 II; eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; mirIs47. Show Description
mirSi16 [flp-18p::lox2272::BFP::tbb-2 3'UTR::lox2272::ChR2-HRDC::SL2::jRGECO1a::unc-54 3'UTR + Cbr-unc-119(+)] II. mirIs47 [sra-6p::TeNL + npr-9p::ChR2-HRDC::YFP::jRGECO1a + unc-119(+) + gpa:14p::CRE]. Blue fluorescence in flp-18 expressing neurons. loxP sites before first (eat-4(mir12[loxP 5'UTR])) and after second exon (eat-4(mir17[loxP intron2])) of eat-4 gene. Lite. Calcium sensitive (Kd 250 nM) teal nanolantern (TeNL) in ASH and PVQ, ChR2-HRDC::YFP and jRGECO1a expression in AIB. Conditional eat-4 KO in ASH (NOT defective) and ChR2-HRDC and jRGECO1a expression in AVA (instead of BFP). Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| MSB657 |
C. elegans |
eat-4(mir12[loxP 5'UTR] mir17[loxP intron2]) III; lite-1 (ce314) X. Show Description
loxP sites inserted before first (eat-4(mir12[loxP 5'UTR])) and after second (eat-4(mir17[loxP intron2])) exon of eat-4 gene. Lite. Reference: Porta-de-la-Riva M, et al. Nat Methods. 2023 May;20(5):761-769. doi: 10.1038/s41592-023-01836-9. PMID: 37024651.
|
|
| NJ242 |
C. elegans |
exc-2(rh90) X. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. 100% penetrant.
|
|
| NJ469 |
C. elegans |
exc-4(rh133) I. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the cell body. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip.
|
|
| NJ582 |
C. elegans |
cul-1(e1756)/unc-69(e587) III. Show Description
Heterozygotes are WT and segregate WT, Unc and Long Thin Steriles (that arrest before the adult stage). cul-1 animals have excess cell divisions in post-L1 blast cell lineages. cul-1 was formerly known as lin-19.
|
|
| NJ731 |
C. elegans |
exc-5(rh232) IV. Show Description
Formation of large round cysts in the excretory canal. The cysts begin to form shortly before hatching and is penetrant. The cysts grow in size throughout larval and adult stages, and can be lethal. The cysts form primarily at the canal tips. Some of the larger cysts may be visible by low power microscopy. Slight variable defects in the tail whip. Impenetrant distal tip cell migration defects (Mig).
|
|
| NK2442 |
C. elegans |
mig-6(qy37[mNG+loxP::mig-6]) V. Show Description
Superficially wild-type. CRISPR/Cas9 insertion of mNeonGreen. Insertion site verified by PCR and sequencing. mNeonGreen is inserted at the N-terminus right before a putative proprotein convertase cleavage site and Western analysis indicates most of the mNeonGreen is cut from the MIG-1 protein and is diffuse in the extracellular fluid. See Figure S1 in Keeley et al., Dev Cell. 2020 Jul 6;54(1):60-74.e7. doi: 10.1016/j.devcel.2020.05.022. PMID: 32585132
|
|
| OD3609 |
C elegans |
faah-4(lt121) III. Show Description
NOTE: This strain can be sensitive to starvation; the authors recommend that anyone using this strain for their work should propagate the stock for several generations after starvation before conducting experiments. Reference: Chen AL, et al. Nat Chem Biol. 2019 Mar 25. doi: 10.1038/s41589-019-0243-4.
|
|
| OH15227 |
C. elegans |
unc-86(ot893[unc-86::3xFlag::mNeonGreen::AID*]) III. Show Description
unc-86(ot893) is a CRISPR/Cas9 engineered translational reporter (nuclear mNeonGreen expression). Endogenous unc-86 locus is tagged 3xFlag::mNeonGreen::AID* (Auxin Inducible Degron) at the 3' end. The mNeonGreen::AID* cassette was inserted right before the stop codon of the unc-86 locus, using a guide RNA that targets a sequence overlapping the unc-86 locus STOP codon (target sequence: GGATTCTTTGATTAGTTTCG). Reference: Serrano-Saiz E, et al. Curr Biol. 2018 Sep 10;28(17):2813-2823.e2. doi: 10.1016/j.cub.2018.06.045. Epub 2018 Aug 23. PMID: 30146154.
|
|
| OH15910 |
C. elegans |
lin-11(ot958[lin-11::GFP::FLAG]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous lin-11 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH15912 |
C. elegans |
vab-7(ot959[vab-7::GFP::FLAG]) III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous vab-7 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16345 |
C. elegans |
ceh-37(ot1023[ceh-37::GFP::FLAG]) X. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-37 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16487 |
C. elegans |
ceh-76(ot1042[ceh-76::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-76 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16505 |
C. elegans |
ceh-89(ot1050[ceh-89::GFP]) X. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-89 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH16925 |
C. elegans |
him-8(e1489) IV; ceh-24(syb1608[ceh-24::GFP]) V. Show Description
Him. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-24 locus; verified by sequencing. Derived by crossing him-8 into parental strain PHX1608. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| OH18111 |
C. elegans |
ttx-1(syb1679[ttx-1::GFP]) ot1264) V. Show Description
ot1264 is a CRISPR deletion removing -10.8 kb to -1.8 kb before the first exon of ttx-1, made in the context of the ttx-1::GFP allele syb1679. Notably ttx-1 expression in RIB is lost, and RIB markers are off or dim. Reference: Reilly MB, et al. Widespread employment of conserved C. elegans homeobox genes in neuronal identity specification. bioRxiv 2022.04.29.490095; doi: https://doi.org/10.1101/2022.04.29.490095
|
|
| OH18594 |
C. briggsae |
Cbr-eat-4(ot1371[Cbr-eat-4::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-eat-4 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18596 |
C. briggsae |
Cbr-unc-25(ot1373[Cbr-unc-25::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Cbr-unc-25 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18619 |
C. elegans |
lim-6(ot1391[lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous lim-6 locus using CRISPR/Cas9. Generated in N2 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18624 |
C. tropicalis |
Ctr-lim-6(ot1392[Ctr-lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-lim-6 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18640 |
C. briggsae |
Cbr-lim-6(ot1393[Cbr-lim-6::GFP]) X. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-lim-6 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18671 |
C. tropicalis |
Ctr-unc-25(ot1397[Ctr-unc-25::T2A::GFP::H2B]) III. Show Description
T2A::GFP::H2B tag inserted before STOP codon of endogenous Ctr-unc-25 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18853 |
C. tropicalis |
Ctr-ceh-32(ot1430[Ctr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Ctr-ceh-32 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18854 |
C. briggsae |
Cbr-ceh-32(ot1431[Cbr-ceh-32::GFP]) V. Show Description
C-terminal GFP tag inserted before STOP codon of endogenous Cbr-ceh-32 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18892 |
C. briggsae |
Cbr-unc-17(ot1440[Cbr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-unc-17 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH18902 |
C. elegans |
degt-1(ot1445[degt-1::GFP]) V. Show Description
GFP tag inserted at the C-terminus of the endogenous degt-1 locus directly before the DEGT-1 stop codon. Reference: Bayer E, et al. 2025. biorxiv: https://www.biorxiv.org/content/10.1101/2025.01.01.631014v2
|
|
| OH19094 |
C. briggsae |
Cbr-lgc-37(ot1475[Cbr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Cbr-lgc-37 locus using CRISPR/Cas9. Generated in C. briggsae AF16 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19123 |
C. tropicalis |
Ctr-lgc-37(ot1487[Ctr-lgc-37::T2A::mScarlet3::H2B]) III. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-lgc-37 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OH19212 |
C. tropicalis |
Ctr-unc-17(ot1513[Ctr-unc-17::T2A::mScarlet3::H2B]) IV. Show Description
T2A::mScarlet3::H2B tag inserted before STOP codon of endogenous Ctr-unc-17 locus using CRISPR/Cas9. Generated in C. tropicalis NIC203 background. Reference: Toker IA, et al. bioRxiv 2024.11.23.624988; doi: https://doi.org/10.1101/2024.11.23.624988.
|
|
| OP50/cytR- |
Escherichia coli |
E. coli [cytR-] Show Description
Bacteria. Kanamycin-resistant E. coli. cytR- mutation in OP50 background causes elavated nucleotide levels similar to HT115. A mutation in CytR- was introduced into the OP50 strain by recombineering. Bacterial cells were transformed with pSIM8 plasmid before using as hosts for recombineering. Targeting substrate DNA fragments were amplified by PCR and subcloned into TOPO cloning vector for sequence verification before being electroporated into the host bacterial cells. The primer set used for cloning targeting cytR substrate DNAs (to replace cytR+ with the cytR- mutation identified in HT115 strain): 5'- GCCAGGCGAGGAGTGAGTGTG-3'/5'-AGCGGCGGGCCTTTGACC-3'. Reference: Chi C, et al. Genes Dev. 2016 Feb 1;30(3):307-20.
|
|
| PHX1551 |
C. elegans |
ceh-51(syb1551[ceh-51::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-51 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1587 |
C. elegans |
tab-1(syb1587[tab-1::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous tab-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1592 |
C. elegans |
ceh-5(syb1592[ceh-5::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-5 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1610 |
C. elegans |
ceh-92(syb1610[ceh-92::GFP]) III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-92 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1656 |
C. elegans |
ceh-8(syb1656[ceh-8::GFP]) I. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-8 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1658 |
C. elegans |
unc-4(syb1658[unc-4::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous unc-4 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1679 |
C. elegans |
ttx-1(syb1679[ttx-1::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ttx-1 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1849 |
C. elegans |
ceh-23(syb1849[ceh-23::GFP)] III. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-23 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1884 |
C. elegans |
ceh-75(syb1884[ceh-75::GFP]) V. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-75 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX1955 |
C. elegans |
ceh-87(syb1995[ceh-87::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-87 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX2015 |
C. elegans |
ceh-58(syb2015[ceh-58::GFP]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-58 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
| PHX2517 |
C. elegans |
ceh-86(syb2517[ceh-86::GFP::FLAG]) II. Show Description
Superficially wild-type. Insertion of GFP and FLAG tags directly before the stop codon of endogenous ceh-86 locus. Verified by sequencing. Reference: Reilly MB, et al. Nature. 2020 Aug;584(7822):595-601. PMID: 32814896.
|
|
