Search Strains

More Fields
Strain Species Genotype Add
PHX6670 C. elegans spig-2(syb6670[spig-2::SL2::GFP::H2B]) V. Show Description
SL2::GFP::H2B cassette inserted directly before the stop codon of the endogenous spig-2 locus. spig-2 also known as txt-17 or F20A1.10. Reference: Aguilar GR & Hobert O. (2024). A protocol to transform a fluorescent reporter from a nuclear to a cytoplasmic location. microPublication Biology. https://doi.org/10.17912/micropub.biology.000954
PHX8408 C. elegans lat-1(syb8408[lat-1AAAAA::EGFP::linker::3xFLAG::AAAAA]) II. Show Description
Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX8955 C. elegans lat-1(syb8955[lat-1 F69A] *syb8408) II. Show Description
Engineered F69A mutation in endogenously-tagged lat-1 locus. Slightly reduced brood size. syb8408 is internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PHX9026 C. elegans lat-1(syb9026[lat-1(delta Lec)] *syb8408) II. Show Description
CRISPR/Cas9-engineered deletion of Lectin domain within endogenously-tagged LAT-1A. Internal eGFP and FLAG tags with poly-A linkers inserted into endogenous lat-1 locus before 651 aa. Reduced brood size and high levels of embryonic and larval lethality. Reference: Carmona-Rosas G, et al. bioRxiv 2023.05.04.539414; doi: https://doi.org/10.1101/2023.05.04.539414.
PS1010 C. angaria Caenorhabditis angaria Show Description
Male-female strain. Gonochoristic. Grows well on OP50. Freezes well with C. elegans protocol. Isolated by Robin Giblin-Davis in October 1990 in Dade County, FL in the abdomen of an adult female of Metamasius hemipterus. Consult Walter Sudhaus or Robin Giblin-Davis for appropriate taxonomy before publication. Do not distribute this strain; other labs should request it from the CGC. sp. 3 in Kiontke and Sudhaus Wormbook Ecology chapter.
SSM289 C. elegans mre-11(iow45[mre-11::gfp::3xflag]) V. Show Description
Homozygous gfp and 3xflag C’ terminal tag inserting just before the STOP codon of mre-11. The strain is fertile and contains wild type germline (examined by DAPI). GFP is expressed in all germline nuclei. Maintain the strain by picking worms at 20C, no selection required. gfp::3xflag was added by CRISPR/Cas9 using pDD282-based vector. Reference: Reichman R, et al. Genetics. 2018 Apr;208(4):1421-1441.
TV24661 C. elegans dma-1(wy1246[dma-1::GFP]) I; wyIs581 IV. Show Description
wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. GFP tag inserted into endogenous dma-1 locus after DMA-1 transmembrane domain and before cytoplasmic tail. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
TV24788 C. elegans wyIs581 IV; wyIs740 V. Show Description
wyIs581 [ser-2(prom3)::myr::mCherry + odr-1p::GFP] IV. wyIs740 [ser-2(prom3)::dma-1::GFP + odr-1p::GFP] IV. GFP inserted into DMA-1 after transmembrane region and before cytoplasmic tail in wyIs740 reporter. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
TV25625 C. elegans dma-1(wy1246[dma-1::GFP])) I; wyIs853 V; wyIs910 X. Show Description
wyIs853 [ser-2(prom3)::mCherry::rab-7 + odr-1p::GFP] V. wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. GFP tag inserted into endogenous dma-1 locus after DMA-1 transmembrane domain and before cytoplasmic tail. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
TV26681 C. elegans wyIs592 III; wyIs740 V; mec-4(e1611) X. Show Description
wyIs592 [ser-2(prom3)::myr::GFP + odr-1p::RFP] III. mec-4(e1611) is a gain of function point mutation. wyIs740 [ser-2(prom3)::dma-1::GFP + odr-1p::GFP] IV. GFP inserted into DMA-1 after transmembrane region and before cytoplasmic tail in wyIs740 reporter. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
TV26950 C. elegans dma-1(wy1286[dma-1::tagRFP]) I; rab-7(wy1390) II; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locusafter the DMA-1 transmembrane domain and before cytoplasmic tail. rab-7(wy1390) = endogenous GFP-FLPon-RAB-7. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
TV26971 C. elegans rab-11.1(wy1389[GFP::FLP::rab-11.1]) dma-1(wy1286[dma-1::tagRFP]) I; wyIs910 X. Show Description
wyIs910 [ser-2(prom3)::FLP + unc-122p::BFP] X. tagRFP tag inserted into endogenous dma-1 locus after the DMA-1 transmembrane domain and before cytoplasmic tail. GFP::FLP tag inserted into endogenous rab-11.1 locus. Reference: Eichel K, et al. Nature. 2022 Sep;609(7925):128-135. PMID: 35978188.
UL2992 C. elegans leEx2992. Show Description
leEx2992 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2994 C. elegans leEx2994. Show Description
leEx2994 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL2996 C. elegans leEx2996. Show Description
leEx2996 [sir-2.1::mCherry + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3294 C. elegans leEx3294. Show Description
leEx3294 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3295 C. elegans leEx3295. Show Description
leEx3295 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UL3351 C. elegans leEx3351. Show Description
leEx3351 [sir-2.1::mCherry + R11A8.5::GFP + rol-6(su1006)]. Rollers. Array contains fosmid WRM0630dF01 with mCherry inserted before sir-2.1 STOP codon and R11A8.5 with GFP inserted just before the STOP codon. Reference: Bamps, S et al. 2009 Mech Aging Devel 130(11-12):762-70.
UP4013 C. elegans bli-4(cs281) I; csEx919. Show Description
csEx919 [WRM069E05 + sur-5p::GFP]. Pick GFP+ to maintain. bli-4(cs281) is a null allele and causes embryonic lethality. csEx919 contains a bli-4(+) fosmid WRM069E05 and rescues bli-4 lethality. cs281 is a 1nt deletion causing a frameshift before the peptidase domain. GTGGGGAACCAATACATACC -> GT-GGGAACCAATACATACC. Reference: Birnbaum SK, et al. PLoS Genet. 2023 Sep 18;19(9):e1010944. doi: 10.1371/journal.pgen.1010944. PMID: 37721936.
VC1632 C. elegans C17E4.6(gk787) I/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
C17E4.6. Maternal effect lethal/sterile deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP gk787 homozygotes (fertile WT whose progeny arrest before reproducing). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. External left primer: GGTGTGTGAAGAGACGCAGA. External right primer: CCAACCCCAACTGCCTACTA. Internal left primer: AGAGCGCGTTTGCACTAATC. Internal right primer: GGAGCCATAGTCGAGAGACG. Internal WT amplicon: 2178 bp. Deletion size: 796 bp. Deletion left flank: AGAAGGAAGCTCCAATGACGAACATTCAAA. Deletion right flank: ACTGTTTTTGAAGAAACGTTTAAAAAAAAC. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
ZM1385 C. elegans hpIs66. Show Description
hpIs66 [nab-1::GFP]. Reporter contains nab-1 genomic clone with 9 kb promoter sequence upstream of ATG, the entire nab-1 gene with GFP inserted immediately before the stop codon, and the 1 kb downstream sequence. Animals are slightly short with malformed tail in hermaphrodites. GFP localized in puncta at synapses in nerve cords and nerve ring. GFP localization also along the excretory canals, and some vulva expression. Reference: Hung W, et al. Development. 2007 Jan;134(2):237-49.