Search Strains

Homozygous viable. Deletion of 2053 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: caatttaacaaaaactgtttcaaaaaacca ; Right flanking sequence: atttgtaatatatcacgtttttactgccca. ech-9 sgRNA A: gtctgtcccgtcttttataa; ech-9 sgRNA B: gaaaagtacctataaaaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Embryonic lethal. Deletion of 1942 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, dead embryos (ve982 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AATGTGTACTCAATATTGACTTGGACTCCA; Right flanking sequence: CATGAGCAGGAAAAACTTTTTTGGCAGGCA. copd-1 crRNA A: TGGCCTCAAGAATCATCTGA; copd-1 crRNA B: GCCTAAAACTACCCTTTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 8336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGCTTGTGATGCTCCACCACCAGCTCCA ; Right flanking sequence: tggcctagaaaaaagttaggccaccaataa. egrh-3 crRNA A: ACGACATTTAAGCTTCAGGG; egrh-3 crRNA B: CACGCGattttctgatacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 2360 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve984 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Note: some, but not all balanced heterozygotes display vulva phenotypes such as blips, explode at vulva, and/or egl. Left flanking Sequence: TGTTCTTCATGAAGATAAAAAGTACTATGC; Right flanking sequence: TGGAGGTCAGATGATCCCAACTGCACGCCG. eftu-2 sgRNA #1: TACAGCTCTCGAAGTATACG; eftu-2 sgRNA #2: ACAGAACCACTTTATCGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve985 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CACGGTTCAAGAAGTCGGTTCTGCACTTGG; Right flanking sequence: aggaacaaaaatgtaaaacaatttgccgag. rpl-21 crRNA A: ATGGCTTGATGTGCTCGATA; rpl-21 crRNA B: tgtcaatatagagaactacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve986 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  Other names: CELE_F53A3.3, uS8, rps-22. Left flanking Sequence: ATGAACGTCCTCGCCGATGCGCTCAACGCC; Right flanking sequence: CACGAGGAGGCCAGAAGAAAGCATTTGGGA. rps-22 crRNA A: ATCAACAACGCCGAGAAGCG; rps-22 crRNA B: ATCCATGATTCCGGCGGAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1097 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTTTTTGGGATATTATTTTTAAAAAACCCT ; Right flanking sequence: ATTGATAAGGTTTTTTTGTTCTTGATTCTT. dhs-20 sgRNA A: GAGATTGTTAAAGGGTGTCC ; dhs-20 sgRNA B: TGGGTCGACCTTGAACACGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs78 [myo-2p::mKate2 + NeoR, I: 12541645 (intergenic)] I. Early larval arrest. Deletion of 598 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2  arrested larvae (ve988 homozygotes), and viable non-GFP mKate2+ animals (hIn1[umnIs78] homozygotes). Maintain by picking wild-type GFP+mKate2+.  Left flanking Sequence: ggtacaATGACGTTCAAGAGACGTAACCAC; Right flanking sequence: tttgaaattataaacctttttgttgcaatc. rps-26 crRNA A: GGAAGAAACAAGAAGAACCG; rps-26 crRNA B: gaacaaacaacTTATGGACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs58 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] V. Sterile. Deletion of 459 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+ heterozygotes, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 ve989 homozygotes (most are inviable, some reach adulthood and are sickly, sterile with a protruding vulva, some may produce a small brood), non-GFP mKate2+ arrested larvae (hT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ and mKate2+. Left flanking Sequence: acttacAGCGGCCTTGAGCATGTCGCTGGT; Right flanking sequence: aggtcgaatgagaaaaaaattaattgatat. rps-17 crRNA A: ATCAGTGTCAACCTTGATGG; rps-17 crRNA B: gcgcaacgtaatagatgaac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2367 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gcgaatttgtgaaatttgggaagagcatga ; Right flanking sequence: cggtttttaaaatacttatgaaatgtagtt. Y42A5A.5 crRNA A: atcaatatgccggagatcgt; Y42A5A.5 crRNA B: GAGTAGGcacaggtgtttcg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1245 Break points: dpy-9 kvs-5 IV. Covered region (Mb) (0.3..0.7) Balancer marked with myo-2p::Venus. Larval arrest. Deletion of 402 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ Venus+, and segregate wild-type GFP+Venus+, GFP+ arrested larvae (ve991 homozygotes),Venus+ dpy-9 (dpy-9(tm9713) kvs-5(tmIs1245) homozygotes). Pick WT bright GFP and check for correct segregation of progeny to maintain . Left flanking Sequence: aattttaaaactacaattcaaatttatttt; Right flanking sequence: AGACTCGTTCGCgtaagttacttttctgaa. rps-24 crRNA A: gcaggtaatattcatcacgA; rps-24 crRNA B: GTACTTCGGCTCAAACTTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Larval arrest. Deletion of 754 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve992 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  Left flanking Sequence: caccgtcttcttgttttccgcttttttcct; Right flanking sequence: gttaacttcatgtcttcaatcaataaattg. rps-29 crRNA A: ttcgaaaaagctgtaaacgg; rps-29 crRNA B: aataacaagatttgacgagg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 2015 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve993 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Note: this strain exhibits ectopic body wall GFP expression. Left flanking Sequence: aaggctcgacatgtaattacacacatacCT; Right flanking sequence: AGGGGAACATCAAGTCCAGGGAATGCATCT. rars-1 crRNA A: GTTATTGAAAATAAGGAAGG; rars-1 crRNA B: TTGGAGTTTCAGCGAGGAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval lethal. Deletion of 1632 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead larvae (ve994 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: AGAGATCGAGGAGCAAGGAGCCGAAGTCCG; Right flanking sequence: TCAAATCTCTTCTTGATGAAATTCATACTG. pars-1 crRNA A: TCTTGTCACCTTTCACACGG; pars-1 crRNA B: CAGTTTTAGACAGTCCTTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1717 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: tgcgctccattggcaaatgaaaacgctccg ; Right flanking sequence: TGGAATTATAAGCAATTTTTCAAAAATCTA. K02D10.4 sgRNA A: cgagaccgaactgttgaggg; K02D10.4 sgRNA B: ATGATGAACACGATGACATC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3675 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CACTTTCTGGGCAAGAGCATTCACCGCCCG ; Right flanking sequence: CGGTTTCGCTGAAAATCGATAATTTTTGGG. Y25C1A.8 sgRNA A: CAGATGCTCATGCTCATGCT; Y25C1A.8 sgRNA B: CCAATTTTGCTTTTCGCGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2442 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATCTAGATTCCACTATAGTTATCCTGGAAA ; Right flanking sequence: GATCTCGACCACTTGGTGCATCGAGTCGTC. ZK1010.10 sgRNA A: CCTAGGAATTCATGACATTg; ZK1010.10 sgRNA B: GTAGAGATGGTAGGATCCGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1535 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGCGCTGATATTTTGAAGCGCACAAAAACC ; Right flanking sequence: GCAAAATGGGCATACAATTCTGCCGTTGTT. ZK1240.5 sgRNA A: GAATGTGCACATAGAAAGTC; ZK1240.5 sgRNA B: CGCGAACCAACTGAGATACC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 398 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCCTGAAAATTAATATTAGGTACCTGACCT ; Right flanking sequence: ACTTGGAAATTGGAGAGCAAGTAAAAGTTA. ZK1240.6 sgRNA A: ACTTCAGAACCTGATATGCA; ZK1240.6 sgRNA B: TAGTCGAGTTATTCGTGCAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3445 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TTGATCGATTTGCTGTTTGACTTTTTTCCG ; Right flanking sequence: AGGCGTACGCTGTGGATGAGAAATTCTATG. nhr-146 crRNA A: CATTTTAAAAGTGCAACGGC; nhr-146 crRNA B: TGAGCTGAGCCATGTGATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Sterile. Deletion of 3478 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 sterile adults (ve1001 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: TATTGTAAACATTAAAATGTGGGAAAACTG; Right flanking sequence: TCCTGATTGTTCCTGTAATTAATTGCATTA. F58G1.2 crRNA A: GGTGAAATCGTCATTGAACG; F58G1.2 crRNA B: CAAGCAACGAGAAACAATGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III. Mel. Deletion of 2623 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) adults that give progeny that die early (ve1002 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: AAAGTTAAATATTGATGTTGAAGTTTGCCT; Right flanking sequence: ATTTTTAATAATAATTCTGAAATTTATTTT. madf-11 crRNA A: GTTCCCATTGAAAAATCACC; madf-11 crRNA B: TTCCAATGAGCGACCGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 3574 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1003 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TGATGCTGTCACGAAGAATGACTATTCCCT; Right flanking sequence: GGGGATACACTTTCCAAGCAGATTGATGAT. ears-1 crRNA A: GAAAATCCTTTCCCAAAAGG; ears-1 crRNA B: CAGCTCCATCGGTCTCCGGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

qIs26 [lag-2::GFP + rol-6(su1006)] III.  Larval arrest. Deletion of 1643 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are Rol GFP+(pharynx and distal tip cell), and segregate Rol GFP+(pharynx and distal tip cell), non-Rol GFP+(pharynx) arrested larvae (ve1004 homozygotes). qC1[qIs26] is homozygous lethal(unknown stage). Maintain by picking Rol GFP+(pharynx and distal tip cell). Left flanking Sequence: TGTAACTCATCTCAAAGCGTGAGAGTTCCT; Right flanking sequence: ATCATAGAAGAATCGTCTTTTGAGAAGATC. gars-1 crRNA A: AGTTATGGATGCCGTTAAGG; gars-1 crRNA B: CAATCATTTGCTATCTATGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

tmIs1208 [myo-2p::mCherry, II: dpy-2] II. Sterile. Deletion of 7616 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mCherry+, and segregate wild-type GFP+ mCherry+, GFP+ non-mCherry sterile adults (ve1005 homozygotes) and Dpy non-GFP mCherry+ (tmC6 homozygotes). Maintain by picking wild-type GFP+ mCherry+.  Note: tsr-1 is near ZK1240.1, the gene marking the breakpoint of the tmC6 balancer. Left flanking Sequence: aaatTTAGATGAACAGCTTGGCGAGATCAC; Right flanking sequence: tagtgagctctagttttcggtgtctaggct. tsr-1 crRNA A: GAGTATGGTTGAAGACGGCG; tsr-1 crRNA B: gctcaattttgaagtctcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 1511 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 sterile adults (ve1006 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GATCGTAGACTGATAATTTTGCATGCTCCT; Right flanking sequence: tacaatgcagaatatgcacaataaatgacg. sqv-4 crRNA A: CGTAATCAAACACTTGATGG; sqv-4 crRNA B: cgagttgattttctgtaggg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Homozygous sterile. Deletion of 7387 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1007 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+.  orai-1 is near unc-45 and therefore near the outer limit of the sC1 balancer. Left flanking Sequence: ATCCTGACGTCAGAGATCTTCTGAAATCCG; Right flanking sequence: GTGTTCCGTCATGCCATTTTAATCTGTGTG. orai-1 crRNA A: CTTTCGAAGTCTCCGTTTCG; orai-1 crRNA B: GTGGCGAGACAGTGAGCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3800 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCCATTTTCTGAAGAAGAAATCACTCATTC ; Right flanking sequence: AGGGAAATTTCGAGCCGCCACAATGGTGAA. F58F9.1_T13A10.2 crRNA A: TGCCTTCTTCGACTGCTTGG; F58F9.1_T13A10.2 crRNA B: CTTATTGTGGCGCGTGCATT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 653 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1009 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: aacacaaacaacgagtgtTTAGGCTTGTTG; Right flanking sequence: ATGGAGGTCGCTCTCGTCATtttacctgaa. rps-19 crRNA A: TCCAGAGGATCTGAGGCTGG; rps-19 crRNA B: CAAGGACGTCGACCAGCACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 748 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1010 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ttacgacccccgttttcaccctcattacca; Right flanking sequence: GGGTGAAGAAGGTCAACGGCCAAAGGCATt. rps-27 crRNA A: atcattggctgtctcgtctc; rps-27 crRNA B: TGATCTCCCTTTGTGGCTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Early larval arrest. Deletion of 1278 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larva (ve1011 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caatcattaaaaacattgccaacagttgaa; Right flanking sequence: AGgtatatataaaacttattatactaaacg. sars-1 crRNA A: aaacagtatcgaagttaagG; sars-1 crRNA B: GACCAAGAAACTGAGTGGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 6547 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ttcccccaaaaagttttgtttcgtatccca ; Right flanking sequence: TGGGAGAATTGGAATGGATTTGATGGTGCC. twk-39 crRNA A: ctgatcgaacctaaagatgg; twk-39 crRNA B: GAGCTTGGCTGTTCTCCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1213 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATTGAAAATTGGCTAACCGATACACGCCT ; Right flanking sequence: AGGCTTTGCGATCAACCTGAAATACATCCT. glct-5 crRNA A: TTCTGAAGATCGCAAAGTGC; glct-5 crRNA B: CGATTTGCAGTAGACATGGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Maternal effect lethal. Deletion of 5068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 adults that lay dead eggs (ve1014 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: TTTGCTCTGTGAGCCACTTCTCATCAATCT; Right flanking sequence: TGGTGTCAACGACCTGATGGGTATAGCGTA. K10C3.5 crRNA A: CATTGATAGTCCGGGACACG; K10C3.5 crRNA B: ACTGTTTCATTCACGTGTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Larval arrest. Deletion of 1304 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1015 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATCGCCACTTCTAAACCTTCTTTTCCGTG; Right flanking sequence: tggtcggagaaaatcctcggccacccggcc. yars-2 crRNA A: CACAATTCGAGTAATTTCGG; yars-2 crRNA B: ttccacaaaactccgcgcgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2047 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GGATCAGTTGTCAAAGCAGTGCGAGAAGCT ; Right flanking sequence: TTAACGCACGTTGTTTGTACAGTCCAAGAG. C55A6.10 crRNA A: TGTTGCAGAAACTGGAGACC; C55A6.10 crRNA B: AAAAATGCGGAAAAATCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Late larval arrest. Deletion of 1778 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 thin slow moving larvae (ve1017 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ATTTTAAATATGGAGTAATTTAGGATGCCA; Right flanking sequence: CGGTGGTTTTGTTTTCTTCGGTGCCTATGA. slc-25A26 crRNA A: ACCACCGATCCTTCTTCTGA; slc-25A26 crRNA B: CGTGTAATGTGGATTTCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Emb. Deletion of 3962 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 dead embryos (ve1018 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: ATAGACTACTATTTGAAGGCTAACTTTCCA; Right flanking sequence: AGGAATTGTGattttatttaaattttgttt. D2045.9 crRNA A: ATTTCCCGGTCAACGCAACG; D2045.9 crRNA B: GACACCGAAACCTAAAAGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 1878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve1019 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ACTTATCGAACGATTTTGTGGTTCATGCCA; Right flanking sequence: TGGAAACAAAAATATTTGAGATGGAAGGAA. idha-1 crRNA A: TCGCTTTACTCCTATCCCAT; idha-1 crRNA B: TTGCCAAGCATTCTGAACCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Sterile. Deletion of 589 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate2 (ve1020 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GGACAACTTAATCTTGAGTGAAATCTTCCT; Right flanking sequence: TACTTCATTTTCTTGCAAAACGATTTCCCA. F32D8.5 crRNA A: ATTAAAAGCAGGTTCAGCGC; F32D8.5 crRNA B: GTAGCGGAGTGAAAGATAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1579 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACGGAATGCCTCGGCTATTTTTCAGTTTTT ; Right flanking sequence: Ctttatttttaagtttttttaatctccctt. F55C10.5 crRNA A: CGGTAAAATTCAGTCTGTCT; F55C10.5 crRNA B: TTTATTATGTGCACACTCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 4718 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCTATCAACTCGTTACGATAAGAATGACCA ; Right flanking sequence: CTCTATAGTCTCTCGATCTATTGACATTAG. C35C5.10 crRNA A: CTTTTCCCCCTCCCGACAAG; C35C5.10 crRNA B: TTGACGTTGTGACAAAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 3334 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ACATCTTGTAAAGTTTTTCGTGTTCTTCCA ; Right flanking sequence: TGGAAAAATCAGACtttagttttttttAAT. F21D5.4 & F21D5.5 crRNA A: TTTCCGCCCGAAATTCGAAG; F21D5.4 & F21D5.5 crRNA B: TCATCAAATCGCCGTTGTCC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 5065 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: atcaaatcgtaatgggacagcatggcacca ; Right flanking sequence: AGGTACGATTTTGTGTTAATTCCTTGGAAA. faah-5 crRNA A: ATTTCCTCTTATAACCcacg; faah-5 crRNA B: TTATTCGAGTGGGCAATTGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2359 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CAGGTTCTCAGAATGGGAAAGATCATGCCG ; Right flanking sequence: GGGATTGAACTTTTACAATTTTAACTTTCA. K07C5.3 crRNA A: TTTGCAGCCACGAAGAAGTT; K07C5.3 crRNA B: ATGCTCTGAGAAGTTATGGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2023 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CCACGGTCGAAAAGCTTCAATCCCTCACCT ; Right flanking sequence: GGTGGATTTGTCTAACCGAAAATTCACAAC. glct-2 crRNA A: GGTTTCAGAACACTCATCGT; glct-2 crRNA B: ATTCTGATTGTCCATTcacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 8422 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GTCTCCTGACTGGGCATATTGAACTTAACA ; Right flanking sequence: CGGCTGAATTTGGTGTGGTCGCTGCACATT. pqn-15 crRNA A: TTCAACTTGAGTTTGATCGG; pqn-15 crRNA B: ATGACCCGATGTGGACCAGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 1827 with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TAGTCAACTTTAACCAACTTTGACTTCTCT ; Right flanking sequence: ACAACTGTTTCACGGTGCAATTTcacaggg. cpr-2 crRNA A: GGATGGCAGTTAGAACGTGG; cpr-2 crRNA B: ATATTTGGCACGACCTCTGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Larval arrest. Deletion of 17737bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested malformed larvae (ve1030 homozygotes), non-GFP mKate2+ arrested animals (arrest stage unknown)(hT2 homozygotes) and dead eggs (aneuploids). Pick wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. [NOTE: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)] Left flanking Sequence: ACCCAACTGACCATTCACCCGTCTCCTCCT; Right flanking sequence: CGGACAGATTCTACGGAAGCACACGAGAAT. tol-1 crRNA A: GGTGGTTGTTGTAGAGGGGG; tol-1 crRNA B: AATCTGCTGGACGATGAGCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

Homozygous viable. Deletion of 2100 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAAATAATGAAAAAAATACAGTAATACAA ; Right flanking sequence: TGGCTCTATTTTTTGGAGTTGATATACATA. ZK418.10 crRNA A: TGAAATTCAGGGAACGTGAG; ZK418.10 crRNA B: TACACCATAGATTTTCAACG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.