Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
RW12196 C. elegans egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV. Show Description
egrh-3(st12196[egrh-3::TY1::EGFP::3xFLAG]) IV.
RG3483 C. elegans egrh-3(ve983[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. Show Description
Homozygous viable. Deletion of 8336 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: GAAGCTTGTGATGCTCCACCACCAGCTCCA ; Right flanking sequence: tggcctagaaaaaagttaggccaccaataa. egrh-3 crRNA A: ACGACATTTAAGCTTCAGGG; egrh-3 crRNA B: CACGCGattttctgatacgg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.