More Fields
Strain Species Genotype
RG3485 C. elegans +/mT1 [umnIs52] II; rpl-21(ve985[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III. Show Description
umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Larval arrest. Deletion of 489 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve985 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny. Left flanking Sequence: CACGGTTCAAGAAGTCGGTTCTGCACTTGG; Right flanking sequence: aggaacaaaaatgtaaaacaatttgccgag. rpl-21 crRNA A: ATGGCTTGATGTGCTCGATA; rpl-21 crRNA B: tgtcaatatagagaactacg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
ZT56 C. elegans fjSi19 II; unc-119(ed3) III. Show Description
fjSi19 [rpl-21p::2×HA::C04F12.1 + Cbr-unc-119(+)] II. Single-copy insertion in the MosSCI locus ttTi5605 (LG II). The 2×HA::C04F12.1 transgene was designed to express a protein with a double HA tag at its N-terminus, using a strong ubiquitous promoter (rpl-21p). The linker sequence between the two HA tags has a NotI site. The insertion can be checked by PCR with the following primers: GGAGCCGATTTGTTCCAGTC (at the 3'-side of C04F12.1) and ATCGGGAGGCGAACCTAACTG (near ttTi5605 on LG II). vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.