umnIs80 [myo-2p::mKate2 + NeoR, I: 6284001] I. Pick wild-type mKate2+ to maintain. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, DpyUnc, arrested hT1 homozygotes (mKate2+), and dead eggs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate transgene into hT1 balancer in parental strain KR1037 using CRISPR/Cas9.

umnIs30 [myo-2p::mKate2 + NeoR, X: 6745526 (intergenic)] I. umnIs24 [myo-2p::GFP + NeoR, X: 15420938 (intergenic)] I. Carries szT1 balancer with mKate2 tag on left arm and GFP tag on right arm. Heterozygotes are wild-type GFP+ & mKate2+, and segregate wild-type GFP+ & mKate2+, DpyUnc non-GFP & non-mKate2, dead eggs and GFP+ & mKate2+ Lon males. Maintain by picking wild-type with GFP+ & mKate2+. Derived by insertion of myo-2p::mKate transgene into szT1 balancer in parental strain CGC35 using CRISPR/Cas9.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Heterozygotes are wild-type mKate+, and segregate wild-type mKate2+, Unc-36 mKate+ (eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs55 [myo-2p::mKate2 + NeoR, V:1005689 (intergenic)] III. Heterozygotes are wild-type mKate2+, and segregate wild-type mKate2+, Unc-36 mKate+(eT1), dead eggs, and DpyUncs. Maintain by picking wild-type mKate2+. Derived by insertion of myo-2p::mKate2 transgene into eT1 balancer in parental strain BC2200 using CRISPR/Cas9.

umnIs73 [myo-2p::mKate2 + NeoR, III: 9421936 (intergenic)] I. Heterozygotes are WT mKate2+ and segregate WT mKate2+, DpyUnc, lethal mKate2+ hT2 homozygotes (arrest stage unknown) and dead eggs (aneuploids). Will throw an occasional mKate+ Dpy non-Unc (similar events were observed in the parental hT2 strain). Pick WT mKate2+ and check for correct segregation of progeny to maintain. Derived by insertion of myo-2p::mKate2 transgene into hT2 balancer in parental strain KR2467 using CRISPR/Cas9. [NOTE: 3/1995: Apparently the lethal mutation is closely linked but not within the balanced region of hT2. It can occasionally recombine away so that the strain will segregate Bli-4 hT2 homozygotes. (Mark Edgley)]

mKate tag inserted at 5' end of endogenous rheb-1 locus. Ubiquitous expression.

mKate GLO (germline optimized) tag inserted at C-terminus of endogenous SCD-1. Red fluorescence in all nuclei. Cas9 guide + PAM: GACTTGGAAGAAGACGGTGG+AGG. Reference: Ailion M, et al. In preparation.

goeEx737 [flp-24p::SL1::GCaMP3.35-SL2::SL2::mKate2::unc-54 3'UTR + unc-119(+)]. ALA-specific expression of GCaMP with an additional mKate marker for expression reference. Pick mKate+ to maintain. High transmission rate (>99%). Reference: Konietzka et al. 2019. Current Biology (accepted).

cpIs54 [mex-5p::mKate::PLC(delta)-PH(A735T)::tbb-2 3'UTR + unc-119 (+)] II. Reporter labels plasma membrane in early embryo. Transgene construct consisted of a germline promoter sequence (mex-5) driving the expression of a fluorescent protein fused to the N-terminus of the pleckstrin homology domain from phospholipase C-(delta)1 (PH domain) and a 2x Flag epitope tag. Reference: Heppert JK, et al. Mol Biol Cell. 2016 Nov 7;27(22):3385-3394.

syIs423 [15xUAS::?pes-10::GCaMP6s::SL2::mKate2::let-858 3'UTR + myo-2p::NLS::mCherry + 1kb DNA ladder(NEB)]. mirIs19 [nlp-12p::gal-4 + unc-122p::mCherry]. Maintain animals at 25C for several generations to enhance mKate expression in DVA to make it visible with a fluorescence dissection scope. Reference: Das R, et al. Sci Adv. 2021 Sep 17;7(38):eabg4617. doi: 10.1126/sciadv.abg4617. PMID: 34533987

Superficially wild-type. CRISPR/Cas9 insertion of mKate. Insertion site verified by PCR and sequencing.

ltSi953 [mec-18p::vhhGFP4::zif-1::operon-linker::mKate::tbb-2 3'UTR + Cbr-unc-119(+)] II. This transgenic strain mediates touch neuron-specific degradation of GFP-tagged proteins; can be combined with endogenous locus GFP-tagging or rescue of a null mutant with a GFP fusion to examine touch neuron-specific functions of target genes. Reference: Wang S, et al. http://biorxiv.org/content/early/2017/01/30/104398

syIs572 [15xUAS::TeTx::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] Neurotoxin cGAL effector.

syIs583 [15xUAS::GCaMP7s::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)] III. In vivo calcium indicator cGAL effector.

syIs587 [15xUAS::GCaMP7f::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector.

syIs612 [15xUAS::GCaMP7b::SL2::mKate::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder (NEB)]. In vivo calcium indicator cGAL effector.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Lvl. Deletion of 2013 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs.  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tgcgcaaaactgtacCTTCTCCTTAACCTC ; Right flanking sequence: Tggtgtaagaacctgaaaaatcatttattc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Ste. Deletion of 2846 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, sterile GFP+ non-mKate adults (ve574 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tagtacaataggcaatgtaaaatcaatgtg ; Right flanking sequence: cggggaaaatagaaaaattcggcccaaatt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1566 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate that give dead eggs (ve589 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaactacggtcaaaatcgttgcgagaccct ; Right flanking sequence: GACACTCATCTCATCTTCCAGTGActtttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1803 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae (ve591 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaattaaaaattttgtgaaagcatgaccaa ; Right flanking sequence: TCTGGAAAGAAACCGATGAACTGATACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest with occassional escapers. Deletion of 3396 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, arrested GFP+ non-mKate larvae with occasional escapers (ve592 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaagtaacaatgaactaaaaacgtgaata ; Right flanking sequence: TTGATTGTCGCAGATTTGAGATGCTTGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 4255 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, dead GFP+ non-mKate larvae (ve593 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: taccattacttctcatgtatgtacccgccg ; Right flanking sequence: gccctctaactgtttctttttgttctgttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

F21D5.1. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 2044 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, Ste GFP+ non-mKate adults (ve599 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaatttttttcagaaATGGATCTCACTGTT ; Right flanking sequence: cataatctcccaaagttttttttaaatttt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous unhealthy. Deletion of 1650 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly animals that can grow up to lay small broods (ve602 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: accgggaaaaatgtgaaattgcgaaactag ; Right flanking sequence: ggagggcaaagtgtattttttaaatgattt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 437 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve607 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: gaagatcaagtatgaaatttaaaattcaac ; Right flanking sequence: ttgttaatgaaatgcgaaacgataaatttt. rpb-12 sgRNA #1: ggctgaacctgtatcatttt; rpb-12 sgRNA #2: ttaaagatattcagaATGGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1033 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve624 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: GACGAATAGTCATTGGTCGTCCATCCTCTC ; Right flanking sequence: attggcggttattcaaattcaatattttac. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 2891 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve637 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: caagATGATGCGCCCACCAATTATCCTGCT ; Right flanking sequence: CAATAAggagatcaatgtgcccctctgtgc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2300 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve641 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Mel. Deletion of 1448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults that lay dead eggs (ve656 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 1849 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve657 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval lethal. Deletion of 2266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve668 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 6878 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve688 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 3088 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve699 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccctttttgtttgccaagattatcagatga ; Right flanking sequence: TGTGGCTTCTTCTCAGCATCAGCAGCAGCA. sgRNA #1: gccaagattatcagatgatc; sgRNA #2: AAATTGTTTCTCTCCTCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 863 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve700 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cgaatttcaggctcaaATGGGTAACCAGTA ; Right flanking sequence: TGTTGGAGAGACAAAACGACCGTGGTAAtc. sgRNA #1: TGCGTTCTGGTTTCACATAC; sgRNA #2: GTTTTGTCTCTCCAACATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Mid-larval arrest, arrested larvae are somewhat Dpy. Deletion of 980 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested somewhat Dpy larvae (ve701 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aggcagcaggcgcataaacaggaaagtaaa ; Right flanking sequence: tcaggtttaaaaaaaattgagttttaagtt. sgRNA #1: cataaacaggaaagtaaagg; sgRNA #2: GTAGCAGCAGACATgatttc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs46 [myo-2p::mKate2 + NeoR, III:9421936 (intergenic)] V. Homozygous larval arrest. Deletion of 682 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate+, and segregate wild-type GFP+ mKate2+ heterozygotes, GFP+ non-mKate2 arrested larvae (ve725 homozygotes), Unc-36 non-GFP mKate+ animals (eT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tcgcgtcgagacccctaaatctgtgcgcct ; Right flanking sequence: tcgggaaatgactcatcgagcctgaaaaat. sgRNA #1: ttctgatatacttttctcaa; sgRNA #2: aaaaaatttgacgggaaatc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 3806 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve733 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaaggaataaaatgaacaaggTCACCGACA ; Right flanking sequence: TCGGGAAGTTTCGCTGTCAAAAGTGACAAT. sgRNA #3: ACCGACATGATGGTGCAGAG; sgRNA #2: CTGGGTAAGTTCCATCCTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 1324 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve740 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aaactttaaaacttgtaacttcataagcaa ; Right flanking sequence: cggtacttctttaaaggtacagcacccgaa. sgRNA #1: aacaacttaaaatcgacccg; sgRNA #2: gatcgcaaaaattcggggta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous sterile. Deletion of 634 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve742 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CGCTTTGTTGATTCGTTTCATTCGATTCTC ; Right flanking sequence: ATTGTCAAGAACATCTAGCAATTCGAAGAT. sgRNA #1: TCTCAATTCTCGATCCCACG; sgRNA #2: TTGAAACATCTCAAGCGAAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 661 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve748 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCATCTTGGAATCAAAGTTGAGATAATCAG ; Right flanking sequence: aggcggtttgctggcgcgtttctcgttcct. sgRNA #1: CAAAGTTGAGATAATCAGAT; sgRNA #2: tcatcatttattattgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous mid larval arrest. Deletion of 348 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve749 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctgaaaaataaaaaatCTATTCCTTTCCGT ; Right flanking sequence: CGGAATTGTTGGATTTGATTGGAGCGACGG. sgRNA #1: aaatCTATTCCTTTCCGTTG; sgRNA #2: CAAATCCAACAATTCCGCCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Emb. Deletion of 4555 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead eggs (ve750 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ccagtaATGACCGAATCCACAAAATCCGGT ; Right flanking sequence: aattcatgtggaatgtttcagaatgttcac. sgRNA #1: GAATCCACAAAATCCGGTGG; sgRNA #2: aacagagaaatcatgaagtt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous animals are sick. Deletion of 586 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sickly larvae (ve751 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids). Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: cagattaaaaaaaaaacttacTTGGCACCA ; Right flanking sequence: AGGTTTTCGTGAAGGAGCAAACATttttga. sgRNA #1: AAGTACTGTTGTACGCGATG; sgRNA #2: AGTTGATTGGCTGTTGCAGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1777 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve756 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: tggagaggattaggaagatgatgaagacca ; Right flanking sequence: tacttgagatatttagtttgaaatgttttt. sgRNA #1: tttgcttcaagttcgtctgc; sgRNA #2: atctctatccactttccgtg. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous early larval lethal. Deletion of 1620 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate dead larvae (ve761 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: CATGCACAGTTGGGAACAGTACAGACTGAT ; Right flanking sequence: AGGAGCAACTGACTTCACAACCTGCAGCTC. sgRNA #1: CGGTATCTTCCTTGAGAACA; sgRNA #2: TTCTTCGCAACTTCAACTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Possible maternal effect: descendants of homozygous animals may be sensitive to starvation (lethal). Deletion of 2127 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate adults (ve778 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: AAATAATTTTGAATTTTCAGTGCTGTGATG ; Right flanking sequence: AGTAGCCAAGGATCTTTTATTCCGGTTTTT. sgRNA #1: TGTTTTCTCACTGGACAAAG; sgRNA #2: CGGCAACAAAATCAGGACGG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 8730 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve782 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: ctTCAGGAGCTGCTCGCCGATGAGCCAAGA ; Right flanking sequence: cacggcgtgcgcgtcagtgtcacgaaacgc. sgRNA #1: GCAAAACTTCGAAAGGCTCT; sgRNA #2: aaattggttgctgacgcgca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous Sterile. Deletion of 1068 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate sterile adults (ve797 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: aatagaagaaaaatatgatattgtCTACCC ; Right flanking sequence: AATTCGTCGGACATgttaaccgaacaagtt. sgRNA #1: AGGCAGTTCGCATCCAATGC; sgRNA #2: ATCAGTGAAAAGGCACAAGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous late larval arrest. Deletion of 1256 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve807 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TCAAACTTATAGTTTTCTTTTTTCAGGTCT ; Right flanking sequence: TGGTGTGACCTGGTTTATTTTCAATCGAAA. sgRNA #1: CGACATTCTCAAAGAATTAC; sgRNA #2: AGATGAGGATATGCGTTAAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.

umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Homozygous larval arrest. Deletion of 1963 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate arrested larvae (ve812 homozygotes), Vul non-GFP mKate2+ (nT1 homozygotes) and dead eggs (aneuploids).  Maintain by picking wild-type GFP+ mKate2+. Maintain by picking wild-type GFP+ mKate2+. Left flanking Sequence: TTTAATTACAAAATATTTTATTTTCAGGTA ; Right flanking sequence: GTACCCACTTCTCACTCATCTCATGGCTCT. sgRNA #1: ATGTTGAGCACTCTTTCCAG; sgRNA #2: TTATGTGAAGGTGAATCCAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.