| CGC61 |
C. elegans |
F36D4.4(umn4[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. Show Description
Homozygous viable. Deletion of 917 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CATGTACTCCCCTATATCTTCCAAACATTC ; Right flanking sequence: TGGACATCTTGGAGCACTTTCTGTGATTCT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
|
|
| SP316 |
C. elegans |
bli-6(mn4) IV. Show Description
Blistered cuticle. Dominant.
|
|
| AMH3 |
C. elegans |
unc-33(mn407) IV; sosIs5. Show Description
sosIs5 [rab-3p::Cerulean-Venus::lgg-1 + unc-119(+)]. Unc.
|
|
| AMH32 |
C. elegans |
juIs76 II; unc-33(mn407) IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II.
|
|
| AMH36 |
C. elegans |
juIs76 II; daf-2(e1370) III; unc-33(mn407) IV. Show Description
juIs76 [unc-25p::GFP + lin-15(+)] II. Unc. Maintain at 15C. Synthetic Lethality at 25C.
|
|
| AMH57 |
C. elegans |
unc-33(mn407); olaEx3013. Show Description
olaEx3013 [ttx-3p:mCherry::eGFP::lgg-1 + unc-122p::mCherry]. Pick animals with mCherry+ coelomocytes to maintain array. Unc. Tandem tags on LGG-1 label immature autophagosomes with both GFP and mCherry, but because GFP is preferentially quenched in an acidic environment, mature structures lose their GFP signal and display solely mCherry signal. Reference: Hill SE & Colon-Ramos D. 2018 bioRxiv 287144; doi: https://doi.org/10.1101/287144
|
|
| AMH69 |
C. elegans |
unc-33(mn407) IV; daf-2(e1370) III. Show Description
Maintain at 15C. Synthetic Lethality at 25C.
|
|
| CGC131 |
C. elegans |
mir-248(umn41[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) X. Show Description
mir-248 pre-miRNA deletion allele in which mir-248 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC132 |
C. elegans |
mir-356(umn42[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) III. Show Description
mir-356 pre-miRNA deletion strain deletion allele in which mir-356 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC135 |
C. elegans |
let-7(umn45[let-7p::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR])/tmC24 [F23D12.4(tmIs1240) unc-9(tm9719)] X. Show Description
tmIs1240 [myo-2p::venus, X: F23D12.4] X. Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous let-7 pre-miRNA via CRISPR/CAS9. Heterozygotes are wild-type GFP+ mScarlet+ and segregate wild-type GFP+ mScarlet+ heterozygotes, mScarlet+ non-GFP dead larvae (umn45 homozygotes) and Mec(Unc) non-mScarlet GFP+ (tmC24 homozygotes). Maintain by picking wild-type GFP+ mScarlet+. Left Flanking: GCAAGCAGGCGATTGGTGGACGGTC, Right Flanking: AGCTGCGTCGTCTTGCTCTCACAAc. sgRNA: AAAATTGCATAGTTCACCGG.
|
|
| CGC136 |
C. elegans |
mir-84(umn46[mir-84p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) X. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-84 pre-miRNA via CRISPR/CAS9. Left Flanking: GTTGAGACATGTATATGTTTTTGTT, Right Flanking: GCTACTATTCATCATACGTCTGCCT. sgRNA: ATTCATCATACGTCTGCCTG.
|
|
| CGC137 |
C. elegans |
mir-241(umn47[mir-241p+SL1::egl-13-NLS::mScarlet-I::c-myc-NLS::linker::mODC(422-461)(E428A/E430A/E431A)::let-858 3' UTR]) V. Show Description
Nuclear mScarlet-I fused to a PEST was inserted in place of the endogenous mir-241 pre-miRNA via CRISPR/CAS9. Left Flanking: CTATTTTTTTCACTTGGATTAGGGG, Right Flanking: GGGATGCTCTTTTTGTACCAAACCG. sgRNA: CCTCAACTTTGACACCCCCG.
|
|
| CGC141 |
C. elegans |
mir-1821(umn48[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-1821 pre-miRNA deletion allele in which mir-1821 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CGC142 |
C. elegans |
mir-359(umn49[lox2272 myo-2p::wrmScarlet + lox511I sqt-1(d) hsp::CRE HygR lox511I + lox2272]) V. Show Description
mir-359 pre-miRNA deletion allele in which mir-359 pre-miRNA was replaced by myo-2p::wrmScarlet. Rollers. Generated in parental strain N2. [NOTE: Low levels of Cre activity can lead to excision of the SEC, causing the strain to lose the Roll phentoype. Pick Rollers to retain full transgene cassette.]
|
|
| CH121 |
C. elegans |
dgn-1(cg121)/dpy-6(e14) unc-115(mn481) X. Show Description
Heterozygotes are WT and segregate WT, DpyUncs, and Ste (and Gon) cg121 homozygotes.
|
|
| SP1377 |
C. elegans |
dpy-11(e224) V; lin-2(e1309) unc-7(mn384) xol-1(mn467) X. Show Description
Animals are DpyUncVul. Can mate at low frequency. N2 males X SP1377 fail to give male progeny. Weak unc-7 allele when not in lin-2 background.
|
|
| SP1382 |
C. elegans |
unc-33(mn407) IV. Show Description
|
|
| SP1416 |
C. elegans |
che-11(mn404) V. Show Description
Dye-filling mutant.
|
|
| SP1444 |
C. elegans |
che-10(mn403) II. Show Description
Dye-filling defective. Reference: Starich TA, et al. 1995 Genetics 193:171-88
|
|
| SP152 |
C. elegans |
him-1(e879) I; mnC1 [dpy-10(e128) unc-52(e444)]/zyg-11(mn40) unc-4(e120) II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, Sterile Unc-4, and males. Maintain by picking WT.
|
|
| SP158 |
C. elegans |
spe-1(mn47) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, Sterile Unc-4, and paralysed DpyUnc. Maintain by picking WT.
|
|
| SP1745 |
C. elegans |
dyf-5(mn400) I. Show Description
Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.
|
|
| SP1789 |
C. elegans |
unc-115(mn481) X. Show Description
Unc. Isolated from RW7097 and not outcrossed.
|
|
| SP1792 |
C. elegans |
smu-1(mn415) I; unc-52(e669su250) II. Show Description
Non-Unc at all temperatures. See also WBPaper00004764.
|
|
| SP1804 |
C. elegans |
smu-2(mn416) unc-52(e669su250) II. Show Description
Non-Unc at all temperatures.
|
|
| SP1981 |
C. elegans |
unc-115(mn481) dpy-6(e14) X; stDp2 (X;II)/+. Show Description
Wt strain throws WT and DpyUncs.
|
|
| SP2533 |
C. elegans |
smu-1(mn415) I; mnIs35. Show Description
mnIs35 [smu-2::GFP + unc-36(+)]. Superficially wild-type. Although unlikely, unc-36 might still be present in the background. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
|
|
| SP2668 |
C. elegans |
smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx142. Show Description
mnEx142 [smu-2::GFP + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
|
|
| SP2686 |
C. elegans |
smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnEx151. Show Description
mnEx151 [smu-1::GFP + smu-2::3xHA + unc-36(+)]. Animals carrying the array should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Without the array smu-2(mn416) suppresses unc-52(e669su250) so animals don't show the Unc-52 phenotype. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
|
|
| SP2688 |
C. elegans |
smu-1(mn415) I; unc-36(e251) III; mnEx156. Show Description
mnEx156 [smu-2::GFP + smu-1::3xHA + unc-36(+)( R1p16)]. Maintain by picking non-Unc.
|
|
| SP2693 |
C. elegans |
smu-2(mn416) unc-52(e669su250) II; unc-36(e251) III; mnIs66. Show Description
mnIs66 [smu-2::HA + unc-36(+)]. Strain should be non-Unc-36 and should be Unc-52 (paralyzed, except for head, as late L4/adult - they look like hockey sticks) at 25 C. Reference: Spartz AK, et al. Mol Cell Biol. 2004 Aug;24(15):6811-23.
|
|