Search Strains

More Fields
Strain Species Genotype Add
AA278 C. elegans dhIs59. Show Description
dhIs59 [Topo::daf-9::GFP + lin-15(+)]. Perinuclear expression in a ventral pair of bilateral neurons identified as the IL1Vs or URAVs in the anterior ganglia. By mid-L2, expression in the cytoplasm of the hypodermis, the syncitial epidermis, but absent from midline, epidermal seam cells. Levels peak around the L2 molt and diminish during L4. In some cases, transient expression seen in the L3 vulval blast cells. Also expressed within the hermaphrodite spermatheca starting in late L4 larvae and continuing eve in old adults. In males, expression in IL1V/URAVs and hypodermis but not somatic gonad. In dauer larvae, strong expression in IL1V/URAV and specifically extends into axonal but not dendritic processes. In post-dauer stages, expression in a pattern similar to reproductively growing animals, except expression is absent in the hypodermis. Grow at 20C. May still contain lin-15(n765) mutation in the background.
AA292 C. elegans daf-36(k114) V. Show Description
Mig on low cholesterol. Single daf-c at 27C, weak Mig. Strong expression in intestine at all stages. Grow at 20C.
AA699 C. elegans din-1(hd36) II. Show Description
non-Daf. Temperature-sensitive phenotypes: at 20C half of the animals are egg-laying defective with occasional mispositioned gonadal arms; at 25C, 18% arrest as embryos: those animals that hatch usually display variable morphology defects in body and pharynx; nearly all animals that live to adults are small, clear, slightly uncoordinated, constipated, and virtually sterile. Maintain at 20C or below.
AA790 C. elegans lin-15B&lin-15A(n765) X; dhEx343. Show Description
dhEx343 [din-1p::din-1E::GFP + lin-15(+)]. Pick GFP+ to maintain. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1s::GFP is detected in hypodermis, seam, intestine, and somatic gonad including the distal tip cells. din-1s is also expressed in neurons, vulval precursors, body wall muscle, pharynx, and all tissues with heterochronic phenotypes or remodeled during dauer. Expression is first detected in a few nuclei by the comma stage of embryogenesis. By hatching, din-1s was widely expressed, albeit weakly. Overall expression in most tissues is detected at various levels into adult and in dauer larvae. Animals with the array are GFP+ and non-Muv. Animals which have lost the array are Muv and non-GFP. din-1p::din-1E::GFP was produced by cloning into Fire Lab vector L3781.
AA82 C. elegans daf-12(rh284) X. Show Description
Gonadal lead cell Mig. Weak heterochronic phenotype in intestine. Weakly daf-c at 25C. Class V allele.
AA968 C.elegans nhr-8(hd117) IV. Show Description
Mig on low cholesterol. Reference: Magner DB, et al. Cell Metab. 2013 Aug 6;18(2):212-24. doi: 10.1016/j.cmet.2013.07.007.PMID: 23931753
ABR156 C. briggsae Cbr-she-1(v35) IV; mfIs42. Show Description
mfIs42 [Cel-sid-2(+) + Cel-myo-2::dsRed]. Maintain at 15C. Feminization is partially-penetrant at 15C; most hermaphrodites are somewhat self-fertile and can lay small broods. Can be maintained by crossing with male siblings. Feminized C. briggsae strain made susceptible to RNAi knock-down by feeding dsRNA due to the transgenic expression of C. elegans SID-2. Generated by crossing parental strains JU1018 with RE665. Reference: Booth LN, eLife 2019 Jul 8;8:e46418. PMID: 31282863.
ABR161 C. elegans hjIs37; ldrIs1. Show Description
hjIs37 [vha-6p::mRFP-PTS1 + Cbr-unc-119(+)]. ldrIs1 [dhs-3p::dhs-3::GFP + unc-76(+)]. mRFP targeted to peroxisomes in intestinal cells. dhs-3::GFP is expressed mainly in intestinal cells and localized to intestinal lipid droplets. Derived by crossing parental strains VS10 and LIU1 and outcrossing six times to ABR lab stock of N2. Reference: Papsdorf K, et al. Nat Cell Biol. 2023 May;25(5):672-684. doi: 10.1038/s41556-023-01136-6. 2023. PMID 37127715.
ABR212 C. elegans acd-1(sta6) delm-2(ok1822) I. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4).
ABR225 C. elegans acd-1(sta6) delm-2(ok1822) I; delm-1(ok1266) IV. Show Description
acd-1 and delm-2 are tandem paralogs. This double mutant was created by CRISPR-engineered deletion of acd-1 in a delm-2(ok1822) background (parental strain RB1523). acd-1(sta6) is predicted to be a null allele (~200bp indel causing frameshift in exon 4). This triple mutant strain was made by crossing the acd-1(sta6) delm-2(ok1822) double mutant with delm-1(ok1226) parental strain RB1177.
ABR339 C. elegans lpin-1(wbm76[lpin-1::GFP]) V. Show Description
GFP tag inserted into endogenous lpin-1 locus. The strain was generated by using 5' attgttgctggcatcaaaaa crRNA for C-terminal lpin-1 editing and using dpy-10 editing as a co-conversion marker, followed by outcrossing twice to ABR lab stock of N2 to eliminate the dpy-10 co-conversion marker. Reference: Papsdorf et al, Nature Cell Biology, 2023, PMID 37127715. [NOTE: This strain was incorrectly named WBM1369 lpin-1(sta10[lpin-1::GFP]) in an earlier version of the paper.]
AC722 C. elegans aph-2(ik7)/hT2 [bli-4(e937) let-?(q782) qIs48] (I;III). Show Description
Heterozygous. Homozygous lethal deletion chromosome balanced by bli-4- and GFP-marked translocation. Heterozygotes are WT with pharyngeal GFP signal, and segregate WT GFP, arrested hT2 aneuploids, and non-GFP ik7 homozygotes (Egl, Mel, but do not display adult-onset sterility). Homozygous hT2[bli-4 let-? qIs48] inviable. Pick WT GFP and check for correct segregation of progeny to maintain. Only heterozygous animals should propagate. aph-2(ik7) is a CRISPR-engineered full deletion of the aph-2 gene (3321 bp deletion). Reference: Brinkley DM, et al. Genetics. 2024 Jul 8;227(3):iyae076. doi: 10.1093/genetics/iyae076. PMID: 38717968. aph-2(ik7) is the first full deletion of the aph-2 gene (3321 bp deletion); it was generated by CRISPR/Cas9, as described in Brinkley et al. 2024 Homozygous aph-2(ik7) animals are Egl and Mel and do not display adult-onset sterility (see Brinkley et al, 2024). Only heterozygous animals from this strain will propagate.
AD213 C. elegans spe-19(eb52) V; asEx83. Show Description
asEx83 [spe-19(+) + myo-3p::GFP]. Pick GFP+ to maintain. asEx83 contains 7.3kb genomic fragment including spe-19 (Y113G7A.10) and 850bp of upstream sequence. Transgene rescues spe-19(eb52) sperm activation defect. GFP+ hermaphrodites are fertile. non-GFP hermaphrodites are sterile. All males are fertile.
AD281 C. elegans spe-45(as38) IV; him-5(e1490) V. Show Description
Him. Temperature-sensitive sterile. Small brood size even at permissive temperatures; pick fertile animals and maintain at 15C. Worms lacking spe-45 function produce morphologically normal and motile sperm that cannot fuse with oocytes despite direct contact in the reproductive tract. spe-45 hermaphrodites and males are subfertile at 16C and sterile at 25C. Reference: Singaravelu G, et al. Current Biology 2015. http://dx.doi.org/10.1016/j.cub.2015.10.055
ADS1002 C. elegans aeaIs10. Show Description
aeaIs10 [rgef-1p::GCaMP6s::3xNLS + lin-15(+)]. Worms express GCaMP6s in all neuronal nuclei. Pan-neuronal imaging strain; suitable for rapid whole-brain imaging due to brightness, good signal to noise ratio, and relative resistance to photo-bleaching. Reference: Susoy V, et al. Cell. 2021 Sep 30;184(20):5122-5137.e17. PMID: 34534446
AE501 C. elegans nhr-8(ok186) IV. Show Description
Approx. 1.3 kb deletion - does not remove entire coding region, might not be null allele. No overt morphological or behavioral abnormalities. Homozygotes are 2-3X more sensitive to colchicine and chloroquine than are N2 animals.
AF5 Oscheius sp. Oscheius sp. wild isolate Show Description
Isolated in Towers Hill State Park in WI. Males are rare. No SDS resistant dauers. Animals are osmosensitive, can be dried competely and recover in water. Rhabditidae. Previously known as Rhabditis sp.
AG166 C. elegans mdf-2(av16) unc-17(e245) IV. Show Description
Reduced brood size. Reduced hatching. Slow growth. Larval lethal. Larval arrest. Bursts at vulva. Suppresses the mat-3 one-cell arrest at 25C.
AG226 C. elegans rol-6(e187) unc-4 (e120)/mnC1 [dpy-10(e128) unc-52(e444) nIs190 let-?] II; him-8(e1489) IV. Show Description
nIs190 [myo-2::GFP]. Him. Heterozygotes are wild-type GFP+ and segregate WT GFP+ heterozygotes, Rol Uncs, dead embryos, and males. nIs190 [myo-2::GFP] integrated in or near mnC1. Approx 0.5% recombination seen between nIs190 and mnC1. Fails to complemement all markers on mnC1.
AG406 C. elegans pezo-1(av144) IV. Show Description
av144 is a CRISPR/Cas9 engineered deletion in the N-terminal region of pezo-1 removing exons 1–13. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
AG416 C. elegans pezo-1(av149) IV. Show Description
av149 is a CRISPR/Cas9 engineered deletion in the C-terminal region of pezo-1 removing the last seven exons (27–33) and introns. Small brood size. Reference: Bai X, et al. Elife. 2020 Jun 3:9:e53603. doi: 10.7554/eLife.53603. PMID: 32490809.
AGD1032 C. elegans glp-1(e2141) III; xzEx1. Show Description
xzEx1 [unc-54p::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD1033 C. elegans glp-1(e2141) III; xzEx3. Show Description
xzEx3 [unc-54p::UbG76V::Dendra2]. Maintain at 15C; sterile at 25C. Pick animals with green fluorescence in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD597 C. elegans uthEx556. Show Description
uthEx556 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD598 C. elegans uthEx557. Show Description
uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD614 C. elegans uthEx633. Show Description
uthEx633 [myo-3p::GFP]. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD710 C. elegans uthIs235. Show Description
uthIs235 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
AGD794 C. elegans hsf-1 (sy441) I; uthIs225. Show Description
uthIs225 [sur5p::hsf-1(CT-Delta)::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. Long-lived, thermotolerant. Small brood size. Reference: Baird NA, et al. Science. 2014 Oct 17;346(6207):360-3.
AGD850 C. elegans rmIs110; uthEx557. Show Description
rmIs110 [F25B3.3p::Q40::YFP]. uthEx557 [sur5p::rpn-6 + myo3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD851 C. elegans rmIs284; uthEx557. Show Description
rmIs284 [F25B3.3p::Q67::YFP]. uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD866 C. elegans rmIs110; uthEx633. Show Description
rmIs110 [F25B3.3p::Q40::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD867 C. elegans rmIs284; uthEx633. Show Description
rmIs284 [F25B3.3p::Q67::YFP]. uthEx633 [myo-3p::GFP]. All animals will express YFP in nervous system; pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD885 C. elegans rrf-3(b26) II; fem-1(hc17) IV; uthEx633. Show Description
uthEx633 [myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD886 C. elegans rrf-3(b26) II; fem-1(hc17) IV; uthEx557. Show Description
uthEx557 [sur-5p::rpn-6 + myo-3p::GFP]. Maintain at 15C; sterile at 25C. Pick animals with GFP expression in body wall muscle to maintain. Reference: Vilchez D, et al. Nature. 2012 Sep 13;489(7415):263-8.
AGD926 C. elegans zcIs4 V; uthIs269. Show Description
zcIs4 [hsp-4::GFP] V. uthIs269 [sur-5p::hsf-1::unc-54 3'UTR + myo-2p::tdTomato::unc-54 3' UTR]. ER stress resistence. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.
AGD927 C. elegans uthIs270. Show Description
uthIs270 [rab-3p::xbp-1s (constitutively active) + myo-2p::tdTomato]. Pick animals with red pharynx to maintain. Reference: Taylor RC, Dillin A. Cell. 2013 Jun 20;153(7):1435-47.
AGK192 C. elegans unc-119(ed3) III; zdIs13 IV; armIs5. Show Description
zdIs13 [tph-1p::GFP] IV. armIs5 [zfp-1(fosmid)::FLAG + unc-119(+)]. Integrated zfp-1 transgene expressed in the germline. Fosmid-based zfp-1::FLAG transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. ChIP with anti-FLAG antibody detects ZFP-1::FLAG localization to promoters of highly expressed genes. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015. Cecere G, et al. Mol Cell. 2013 Jun 27;50(6):894-907.
AGK233 C. elegans unc-119(ed3) III; niDf199 IV; armEx58. Show Description
armEx58 [WRM0611aH08-Del8mer + unc-119(+)]. Pick non-Unc to maintain. This strain contains a transgenic array that expresses a derivative WRM0611aH08 fosmid. The WRM0611aH08 fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. This derivative fosmid construct lacks the upstream 8-mer motif (CTGTTTCA) next to 21U-3372. The expression of this individual 21U-RNA is lost in transgenic animals. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK234 C. elegans unc-119(ed3) III; niDf199 IV; armEx53. Show Description
armEx53 [WRM0611aH08 + unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. This strain contains a transgenic array that expresses the WRM0611aH08 fosmid construct. This fosmid contains the niDF199 locus (around 4 kb) that is deleted in the natural C. elegans isolate strain JU258. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to this deletion of the niDF199 locus. Expression of this fosmid construct in JU258 worms restores the expression of the missing 21U-RNAs in the germline, as measured by RT-qPCR. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK26 C. elegans unc-119(ed3) III; armEx5. Show Description
armEx5 [zfp-1(fosmid)::GFP + unc-119(+)]. Pick non-Unc to maintain. Fosmid-based zfp-1::GFP transgene fully rescues stress-sensitivity and reduced lifespan in zfp-1(ok554) homozygotes. Nuclear expression of zfp-1::GFP is observed ubiquitously in somatic cells in all developmental stages; high levels of GFP expression is observed in oocytes with lower levels of expression in the distal germline. References: Mansisidor AR, et al. PLoS Genet. 2011 Sep;7(9):e1002299. Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK280 C. elegans zfp-1(ok554) unc-119(ed3) III; armEx14. Show Description
armEx14 [PHD1-PHD2::FLAG + zfp-1(short isoform) + unc-119(+)]. Pick non-Unc animals to maintain. The fosmid-based armEx14 transgene rescues zfp-1(ok554)/nDf17 lethality. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK369 C. elegans zfp-1(ok554) III; armIs8. Show Description
armIs8 [zfp-1(short isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs8 transgene rescues the protruded vulva phenotype of zfp-1(ok554). Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK370 C. elegans zfp-1(ok554) III; armIs9. Show Description
armIs9 [zfp-1(long isoform)::FLAG::GFP + rol-6(su1006)]. Rollers. The fosmid-based armIs9 transgene rescues zfp-1(ok554)/nDf17 lethality. Ubiquitous nuclear localization of zfp-1(long isoform)::FLAG::GFP is observed in somatic cells in all developmental stages, but is silenced in the germline. See AGK26 for germline-expressing zfp-1::GFP. Reference: Avgousti DC, et al. Mol Cell Biol. 2013 Mar;33(5):999-1015.
AGK532 C. elegans unc-119(ed3) III; niDf199 IV; armEx196. Show Description
armEx196 [mex-5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)]. Pick non-Unc to maintain. unc-119(ed3) was crossed into JU258, the niDf199IV deletion was confirmed by PCR, and these Unc worms were used for bombardment. JU258 worms lack specific 21U-RNAs normally present in N2 worms due to deletion of the niDF199 locus. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK541 C. elegans armSi1 II; unc-119(ed3) III. Show Description
armSi1 [mex5p::unc-130::GFP::tbb-2 3'UTR + Cbr-unc-119(+)] II. GFP expression from transgene is observed in the germline. Reference: Cecere G, et al. Mol Cell. 2012 Sep 14;47(5):734-45.
AGK573 C. elegans otIs225 II; daf-18(ok480) IV; armEx218. Show Description
otIs225 [cat-4::GFP] II. armEx218 [unc-119p::daf-18 + unc-119p::tagRFP + rol-6(su1006)]. Pick Rollers to maintain. Transgenic array expresses DAF-18 from unc-119 pan-neuronal promoter; rescues the HSN under-migration phenotype in daf-18 null mutants. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK587 C. elegans armEx227. Show Description
armEx227 [pak-1p::NLS::tagRFP + rol-6(su1006)]. Pick rollers to maintain. pak-1p::NLS::tagRFP is expressed primarily in the hypodermal tissue during the comma and 1.5-fold stages, and in the CAN cells at the 3-fold stage through adulthood. Expression can also be seen in additional neurons during the larval and adult stages. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK640 C. elegans zdIs13 IV; pak-1(ok448) X; armEx252. Show Description
zdIs13 [tph-1p::GFP] IV. armEx252 [dpy-7p::pak-1::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx252 rescues the pak-1(ok448) HSN under-migration phenotype. pak-1::tagRFP is expressed in the hypodermal tissue throughout development and adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AGK650 C. elegans daf-16(mu86) I; zdIs13 IV; armEx257. Show Description
zdIs13 [tph-1p::GFP] IV. armEx257 [dpy-7p::daf-16b::tagRFP + myo-2::GFP]. Pick animals with GFP+ pharynx to maintain. armEx257 rescues the daf-16(mu86) HSN undermigration phenotype. dpy-7p::daf-16b::tagRFP expression is localized to nuclei in hypodermal tissue during the comma, 1.5 and 2-fold stages, becoming cytoplasmic or perinuclear by the 3-fold stage and persisting into adulthood. Reference: Kennedy LM, et al. Cell Rep. 2013 Sep 12;4(5):996-1009.
AH12 C. elegans gap-1(ga133) X. Show Description
Null allele.