Search Strains

gaEx228 [Y62H9A.6::Dendra2 + Cbr-unc-119(+)]. Pick non-Unc to maintain. Translational Y62H9A.6::GFP reporter expressed in the uterine lumen of adult hermaphrodites. Reference: Zimmerman S, et al. 2015.

gaIs290 [elt-2::TY1::EGFP::3xFLAG(92C12) + unc-119(+)]. RNAi-resistant. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of coding sequence by recombineering. Recombineered fosmid was integrated by biolistic bombardment. References: Sarov, M, et al. Nat Methods (2006) 10:839-44. Mann F, et al. PLoS. Strain was constructed as part of the Regulatory Element Project, part of modENCODE (http://www.modencode.org)

Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.

Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.

Heterozygotes are WT and segregate WT, Sterile Vuls, and Dpy Uncs.

mCherry inserted into endogenous nxf-1locus using CRISPR/CAS9 engineering. Reference: Xu D, et al. Cell Rep. 2023 Aug 29;42(8):112915. doi: 10.1016/j.celrep.2023.112915. PMID: 37537842.

GFP::3xFlag inserted into endogenous dcr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

GFP::3xFlag inserted into endogenous hrde-2 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

tagRFP inserted into endogenous deps-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

3xFlag::GFP inserted into endogenous gld-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

GFP::3xFlag inserted into endogenous simr-1 locus using CRISPR/CAS9 engineering. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

ustSi32 [tofu-6p::tofu-6::GFP::3xFlag::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

ustSi25 [wago-4p::3xFlag::GFP::wago-4::wago-4 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Xu F, et al. Cell rep. 2018 May 22;23(8):2482-2494. doi: 10.1016/j.celrep.2018.04.072. PMID: 29791857.

ustSi56 [tofu-6p::tofu-6::mCherry::tofu-6 3'UTR + Cbr-unc-119(+)] II. Inserted into oxTi444 of parental strain EG8080. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

ustSi60 [pics-1p::pics-1::GFP::3xFlag::pics-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

ustSi64 [wago-3p::3xFlag::GFP::wago-3::wago-3 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Huang X, et al. 2024. Dev Cell. Compartmentalized localization of perinuclear proteins within germ granules in C. elegans.

ustSi106 [wago-1p::3xFlag::GFP::wago-1::wago-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Chen X, et al. Nat Commun. 2024 Jul 10;15(1):5799. doi: 10.1038/s41467-024-50027-3. PMID: 38987544.

ustSi55 [pid-1p::pid-1::GFP::3xFlag::pid-1 3'UTR + Cbr-unc-119(+)] II. Inserted into ttTi5605 of parental strain EG4322. Reference: Zeng C, et al. Cell Rep. 2019 Jun 18;27(12):3561-3572.e3. doi: 10.1016/j.celrep.2019.05.076. PMID: 31216475.

Heterozygotes are Unc and express myo-2::GFP in the pharynx. spe-42(tn1231) homozygotes are non-Unc and non-GFP. spe-42(tn1231) produces <1 self progeny at 16C and no self progeny at 25C. The Spe defect can be rescued by WT sperm. Homozygous nT1[unc-?(n754) let-? qIs50] are embryonic lethal.

Prolonged lethargus duration. Reference: Kawano T., et al. Cell Rep. 2023 Mar 28;42(3):112267. PMID: 36924492.

dvIs67 [tbb-6p::GFP + myo-3p::dsRed]. Derived by out-crossing CL3462.

stxEx39 [alx-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of alx-1 coding sequence in fosmid WRM064D_F05 by recombineering (TransgeneOme bacterial clone 095794875301489 F02). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308

stxEx48 [C01A2.4::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of C01A2.4 coding sequence in fosmid WRM061C_F01 by recombineering (TransgeneOme bacterial clone 7225558184899882 D12). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308

stxEx35 [istr-1::TY1::eGFP::3xFLAG + Cbr-unc-119(+)]. Pick non-Unc to maintain. Constitutive expression of GFP. TY1::EGFP::3xFLAG tag inserted in frame at C-terminus of istr-1 coding sequence in fosmid WRM0636D_F01 by recombineering (TransgeneOme bacterial clone 5438954842362824 D10). Reference: Radetskaya O, et al. The PMK-3 (p38) Mitochondrial Retrograde Response Functions in Intestinal Cells to Extend Life via the ESCRT Machinery. bioRxiv 797308; doi: https://doi.org/10.1101/797308

ssd9 is a Class III supersized lipid droplet mutation. 68bp deletion 5' flanking sequence: cacacatccgtacgtggtgg. 3' flanking sequence: cgacaactgattggttatga References: Li S, et al. G3 (Bethesda). 2016 Aug 9;6(8):2407-19. Li S, et al. Proc Natl Acad Sci U S A. 2017 Aug 15;114(33):8841-8846. cyp-37A1 previously known as drop-1.

Bli. Unc.

WT strain.

WT strain.

WT strain. Occassionally Uncs appear.

Defective in dye filling (FITC or DiO) of amphid and phasmid neurons. Chemotaxis defective. Animals slightly short.

Unc. Isolated from RW7097 and not outcrossed.

Wt strain throws WT and DpyUncs.

LETHAL LATE LARVAL SEX-INFLUENCED Maintain by picking WT.

LETHAL EARLY LARVAL. Maintain by picking WT.

Pick wild-type to maintain. Segregates wild-type and lethals. mnDp1 duplication rescues unc-3 & let-2. mnDp1 is homozygous lethal.

FERTILITY POOR LETHAL EARLY LARVAL Maintain by picking WT.

LETHAL EARLY LARVAL. Maintain by picking WT.

Segregates Unc and WT. Maintain by picking WT.

WT phenotype.

sraEx230 [str-2p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AWC(on) was inhibited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx278 [npr-9p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx279 [ttx-3p::Arch::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx281 [ttx-3p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIY and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is decreased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the same direction the head was bent when AIY was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx291 [npr-9p::chop-2(H134R)::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AIB and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx301 [str-2p::chop-2(H134R)::TagRFP + str-2p::TagRFP + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses TagRFP in AWC(on) and has little response to blue light in the absence of ATR. In the presence of ATR the reversal rate of the animal is increased upon symmetrical stimulation, and asymmetrical stimulation causes the worm to turn in the opposite direction to which the head was bent when AWC(on) was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx306 [ser-2(prom2)::chop-2(H134R)::TagRFP + ser-2(prom2)::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in AIY, AIZ and RME in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of AIY causes the worm to turn in the same direction the head was bent when AIY was excited, whereas asymmetrical stimulation of AIZ or RME causes the worm to turn in the opposite direction to which the head was bent when AIZ or RME was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraEx329 [odr-2(prom18)p::chop-2(H134R)::TagRFP + odr-2(18)p::mKO + pBX(pha-1(+))]. Maintain at 25C. This transgenic line expresses mKO and TagRFP in SMB in the head, and has little response to blue light in the absence of ATR. In the presence of ATR asymmetrical stimulation of SMB causes the worm to turn in the same direction the head was bent when SMB was excited. Reference: Kocabas A, et al. Nature. 2012 Sep 23. doi: 10.1038/nature11431.

sraIs49 contains [nmr-1p::G-CaMP + unc-119(+)]. sraEx80 contains [sra-6p::chop-2(H134R)::mCherry + osm-10p::G-CaMP + unc-122p::mCherry]. Superficially wild-type. Maintain by picking red fluorescent worms.