| SP238 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-1(mn119) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT.
|
|
| SU1085 |
C. elegans |
tes-1(jc110[mScarlet-1::FLAG::tes-1 + LoxP511]) IV. Show Description
mScarlet and FLAG tags inserted into endogenous tes-1 locus by CRISPR/Cas9 genome editing. Reference: Lynch AM, et al. Curr Biol. 2022 Dec 5;32(23):5189-5199.e6. doi: 10.1016/j.cub.2022.10.045. PMID: 36384139.
|
|
| SU896 |
C.elegans |
hmp-1(jc58[hmp-1::mScarlet-1 + Lox511]) V. Show Description
mScarlet tag inserted into endogenous hmp-1 locus by CRISPR/Cas9 genome editing. Reference: Serre JM, et al. PLoS Genet. 2023 Mar 3;19(3):e1010507. doi: 10.1371/journal.pgen.1010507. PMID: 36867663.
|
|
| BC2036 |
C. elegans |
let-100(s1160) unc-22(s7) unc-31(e169)/nT1 IV; +/nT1 V. Show Description
Heterozygotes are WT and segregate WT, Vul, UncLet and dead eggs. Lethal early larval. Maintain by picking WT.
|
|
| HS458 |
C. elegans |
let-19(os33)/mIn1 [dpy-10(e128) mIs14] II. Show Description
Heterozygotes are WT GFP+ and segregate WT GFP+, Dpy GFP+ (mIn1 homozygotes), and os33 homozygotes (GFP-, Dpy, Muv, Steriles).
|
|
| HS616 |
C. elegans |
osEx108. Show Description
osEx108 [(pAY105) let-19::GFP + rol-6(su1006)]. Rollers. Pick rollers to maintain. Reference: Yoda et al. Development (2005) vol. 132 (8) pp. 1885-93.
|
|
| KR1355 |
C. elegans |
let-114(h716) dpy-5(e61) unc-13(e450) I; sDp2 (I;f). Show Description
Animals with the duplication are Unc. Animals which have lost the duplication are DpyUnc and arrest in early/mid larval development.
|
|
| SP232 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-10(mn113) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT.
|
|
| SP235 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-11(mn116) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT.
|
|
| SP236 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-16(mn117) X. Show Description
FERTILITY POOR LETHAL EARLY LARVAL Maintain by picking WT.
|
|
| SP239 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-14(mn120) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT.
|
|
| SP240 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-12(mn121) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT.
|
|
| SP241 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-18(mn122) X. Show Description
LETHAL EMBRYONIC. WT strain.
|
|
| SP244 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-12(mn125) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT. mn125 pka let-17.
|
|
| SP246 |
C. elegans |
mnDp1 (X;V)/+ V; unc-3(e151) let-15(mn127) X. Show Description
LETHAL EARLY LARVAL. Maintain by picking WT.
|
|
| SP364 |
C. elegans |
let-19(mn19) unc-4(e120)/mnC1 [dpy-10(e128) unc-52(e444)] II. Show Description
Hets are WT and segregate WT, paralysed DpyUnc, and early larval Unc-4. Maintain by picking WT.
|
|
| VC10110 |
C. elegans |
let-19(gk908) unc-4(e120) II. Show Description
K08F8.6. Unc. External left primer: TCAATGCCTGGAGATGATGA. External right primer: CCCGCCTTCTTTATCTGTTG. External WT amplicon: 434 bp. This strain carries a point mutation in K08F8.6. The mutation is gk908, which is a G->A mutation at K08F8 coordinate 36647 (flanking sequences AATGGTTGAAGAAAGCAAGAAGGAAAGTTA and CAAACAACAGATAAAGAAGGCGGGGCAGTA). Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|
| VC1165 |
C. elegans |
let-19&sgn-1(ok331)/mIn1 [mIs14 dpy-10(e128)] II. Show Description
F07H5.2, K08F8.6. Homozygous sterile deletion chromosome balanced by GFP- and dpy-10-marked inversion. Heterozygotes are WT with relatively dim pharyngeal GFP signal, and segregate WT dim GFP, Dpy bright GFP (mIn1 homozygotes), and non-GFP ok331 homozygotes (grotty sterile Dpy with vulval blip). Pick WT dim GFP and check for correct segregation of progeny to maintain. External left primer: TGAAAATTGGGAGTTCGGAG. External right primer: ACCACTTGTTCCTTGCCAAC. Internal left primer: GGACTGGAAACTCCAAGCAG. Internal right primer: GACTGATGAGCCGGTATGGT. Internal WT amplicon: 2637 bp. Deletion size: 1456 bp. Attribution: This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence WBPaper00041807
|
|