Caenorhabditis Genetics Center (CGC)

More Fields
Strain Species Genotype
CB518 C. elegans bli-5(e518) III. Show Description
Blistered cuticle. Small. Bursae abnormal. Males abnormal. M-MATING-NO SUCCESS.
NM979 C. elegans unc-64(js115)/bli-5(e518) III. Show Description
Heterozygotes are WT and segregate WT, Bli and L1 arrested paralyzed animals (js115 homozygotes). Well balanced.
RG3018 C. elegans sra-39(ve518[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II. Show Description
Homozygous viable. Deletion of 2040 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TGAATTCGGTCTTGCCTCTTTTTTCCTAAC ; Right flanking sequence: TGAGGTACCTTGAAAAATAATAGCAAATAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.
SP1104 C. elegans unc-25(e156) bli-5(e518) III. Show Description
Bli. Unc.